β 1 Adrenergic Receptor Polymorphisms Arg389Gly and Ser49Gly in the Amerindian and Mestizo Populations of Mexico

Abstract

Several polymorphisms in the CYP1A1 locus have been identified and their genotypes appear to exhibit population frequencies that depend on ethnicity. We studied two CYP1A1 polymorphic sites (position 4889 and 6235) in a group of 212 unrelated healthy individuals belonging to three different Mexican populations (106 Mexican Mestizos, 52 Teenek and 54 Mayos). Comparison among Mexican populations showed increased frequency of the *Ile allele (A on position 4889) in Mexican Mestizos when compared to Amerindians ( p < 0.05). The analysis of position 6235 showed increased frequencies of *m2 (C in this position) allele in Teenek when compared to Mestizos and Mayos ( p < 0.05) and of *m2/*m2 genotype when compared to Mestizos ( p < 0.05). Amerindian populations (from Mexico and South America) presented the lowest frequencies of *Ile (position 4889) and *m1 (position 6235) alleles, however these frequencies vary according to the ethnic group studied. Mexican Amerindian groups together with other South Amerindian populations showed the highest frequencies for *Val at position 4889 and the *m2 allele at position 6235. The present study corroborates the high frequencies of *Val and *m2 alleles in the Amerindian populations and detects some differences between Mexican populations that correlate with linguistic differences. Our data could be helpful in understanding the distribution of these polymorphisms and in clarifying their roles as genetic and evolution markers in Amerindian populations.

Association of β1 and β2-adrenoceptor Polymorphisms With the Demand of Inotropic Catecholamine Support Following Coronary Artery Bypass Grafting in Iranian Population

“…Regarding the genotypes found in our population, the homozygous Gly49Gly-β 1 AR variant was observed only in one patient. The Gly49Gly variant is extremely rare and its lower frequency was also reported in previous studies within various ethnic populations (22)(23)(24)(25). Furthermore, in good accordance with our data, Gly16-β 2 AR and Gly16Gly-β 2 AR were reported as the most prominent alleles and genotypes among different ethnic populations (White and Black Americans, Chinese and Egyptian populations) [26,27].…”

Correlation of renin angiotensin system (RAS) candidate gene polymorphisms with response to Ramipril in patients with essential hypertension

“…The sequence containing this polymorphism was amplified using PCR. [ 13 ] The sense and antisense primers used were: 5′CCGGGCTTCTGGGGTGTTCC3-′ and 5′GGCGAGGTGATGGCGAGGTAGC3-′. The 564 bp PCR product was digested using the enzyme Eco 0109I [New England biolabs] (giving 345 and 219 bp fragments if the polymorphism was present.…”

Obesity is associated with the Arg389Gly ADRB1 but not with the Trp64Arg ADRB3 polymorphism in children from San Luis Potosí and León, México

“…For instance, the Arg389 variant in the ADRB1 gene has been associated with higher BMI as well as other related disorders such as insulin resistance, hypertension and acute myocardial infarction [ 10 – 13 ] . However, the allele frequency of this polymorphism is different among ethnic groups [ 14 - 15 ] . That is why in certain populations the Arg389Gly polymorphism does not seem to impact on the pathogenesis of obesity and traits correlated with it [ 16 ] .…”