18S-NemaBase: Curated 18S rRNA Database of Nematode Sequences

Gattoni, Kaitlin; Gendron, Eli M. S.; Sandoval-Ruiz, Rebeca; Borgemeier, Abigail; McQueen, J. Parr; Shepherd, Rachel; Slos, Dieter; Powers, Thomas O.; Porazinska, Dorota L.

doi:10.2478/jofnem-2023-0006

Cited by 10 publications

(14 citation statements)

References 79 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This methodological limitation prevented the use of traits representing body size, as those traits can change across life stages, show phenotypic plasticity, and are imprecise when applied at the genus level (Mulder & Vonk, 2011). Primers amplifying longer fragments could provide a more accurate taxonomic identification and enable better differentiation of closely related species (Ficetola et al., 2023; Gattoni et al., 2023). However, long markers are suited for the analysis of DNA extracted directly from specimens and are not appropriate for DNA extracted from soil.…”

Section: Discussionmentioning

confidence: 99%

Local climate modulates the development of soil nematode communities after glacier retreat

Guerrieri,

Cantera,

Marta

et al. 2023

Global Change Biology

View full text Add to dashboard Cite

The worldwide retreat of glaciers is causing a faster than ever increase in ice‐free areas that are leading to the emergence of new ecosystems. Understanding the dynamics of these environments is critical to predicting the consequences of climate change on mountains and at high latitudes. Climatic differences between regions of the world could modulate the emergence of biodiversity and functionality after glacier retreat, yet global tests of this hypothesis are lacking. Nematodes are the most abundant soil animals, with keystone roles in ecosystem functioning, but the lack of global‐scale studies limits our understanding of how the taxonomic and functional diversity of nematodes changes during the colonization of proglacial landscapes. We used environmental DNA metabarcoding to characterize nematode communities of 48 glacier forelands from five continents. We assessed how different facets of biodiversity change with the age of deglaciated terrains and tested the hypothesis that colonization patterns are different across forelands with different climatic conditions. Nematodes colonized ice‐free areas almost immediately. Both taxonomic and functional richness quickly increased over time, but the increase in nematode diversity was modulated by climate, so that colonization started earlier in forelands with mild summer temperatures. Colder forelands initially hosted poor communities, but the colonization rate then accelerated, eventually leveling biodiversity differences between climatic regimes in the long term. Immediately after glacier retreat, communities were dominated by colonizer taxa with short generation time and r‐ecological strategy but community composition shifted through time, with increased frequency of more persister taxa with K‐ecological strategy. These changes mostly occurred through the addition of new traits instead of their replacement during succession. The effects of local climate on nematode colonization led to heterogeneous but predictable patterns around the world that likely affect soil communities and overall ecosystem development.

show abstract

Section: Discussionmentioning

confidence: 99%

Local climate modulates the development of soil nematode communities after glacier retreat

Guerrieri,

Cantera,

Marta

et al. 2023

Global Change Biology

View full text Add to dashboard Cite

show abstract

“…Another nematode 18S rRNA database, 18S-NemaBase, was recently published (Gattoni et al, 2023). Although 18S-Nemabase is an excellent resource, their method of quality assurance is labourintensive and difficult to keep updated.…”

Section: New Rrna Cistron Databases For Nematodesmentioning

confidence: 99%

A set of nematode rRNA cistron databases and a primer assessment tool to enable more flexible and comprehensive metabarcoding

Charrier,

Chen,

Thundathil

et al. 2024

Molecular Ecology Resources

View full text Add to dashboard Cite

The ITS‐2‐rRNA has been particularly useful for nematode metabarcoding but does not resolve all phylogenetic relationships, and reference sequences are not available for many nematode species. This is a particular issue when metabarcoding complex communities such as wildlife parasites or terrestrial and aquatic free‐living nematode communities. We have used markerDB to produce four databases of distinct regions of the rRNA cistron: the 18S rRNA gene, the 28S rRNA gene, the ITS‐1 intergenic spacer and the region spanning ITS‐1_5.8S_ITS‐2. These databases comprise 2645, 254, 13,461 and 10,107 unique full‐length sequences representing 1391, 204, 1837 and 1322 nematode species, respectively. The comparative analysis illustrates the complementary value but also reveals a better representation of Clade III, IV and V than Clade I and Clade II nematodes in each case. Although the ITS‐1 database includes the largest number of unique full‐length sequences, the 18S rRNA database provides the widest taxonomic coverage. We also developed PrimerTC, a tool to assess primer sequence conservation across any reference sequence database, and have applied it to evaluate a large number of previously published rRNA cistron primers. We identified sets of primers that currently provide the broadest taxonomic coverage for each rRNA marker across the nematode phylum. These new resources will facilitate more comprehensive metabarcoding of nematode communities using either short‐read or long‐read sequencing platforms. Further, PrimerTC is available as a simple WebApp to guide or assess PCR primer design for any genetic marker and/or taxonomic group beyond the nematode phylum.

show abstract

“…All 15 primers selected for our analyses target the 18S rDNA region of nematodes (Table 1, Fig 1). Among these primers, 13 were selected because they have been identified by a previous review as the primers more commonly used in nematode metabarcoding [10]. One additional primer, Euka02 [31] is often used for metabarcoding of eukaryotic eDNA and it has been suggested to provide a good estimate of nematode diversity [8,12,[31][32][33].…”

Section: Primer Selectionmentioning

confidence: 99%

“…The availability of high-quality, curated databases is pivotal to test the performance of metabarcoding primers. We based our analyses on the 18S-NemaBase [10], which represents the 1813F-2646R CTGCGTGAGAGGTGAAAT GCTACCTTGTTACGACTTTT 500-1000 [44] 18SILVOmidF-18SILVOmidR CAAGTCTGGTGCCAGCAG GAGTCTCGCTCGTTATCGG 500-1000 [48] 3NDf-1132rmod GGCAAGTCTGGTGCCAG TCCGTCAATTYCTTTAAGT 300-700 [51] EcoF-EcoR GGTTAAAAMGYTCGTAGTTG TGGTGGTGCCCTTCCGTCA 300-700 [48] Ek-NSF573-Ek-NSR951…”

Section: In Silico Pcrmentioning

confidence: 99%

“…The biodiversity of nematodes is estimated to be 1-10 million species, but less than 30,000 species have been described using morphology [6]. Recent advances in DNA metabarcoding have fostered the study of nematode biodiversity from a range of environments, highlighting their impressive diversity and the multiple key roles they play [2,3,[7][8][9][10][11][12].…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

In silico assessment of 18S rDNA metabarcoding markers for the characterization of nematode communities

Ficetola,

Guerrieri,

Cantera

et al. 2024

PLoS ONE

View full text Add to dashboard Cite

Nematodes are keystone actors of soil, freshwater and marine ecosystems, but the complexity of morphological identification has limited broad-scale monitoring of nematode biodiversity. DNA metabarcoding is increasingly used to assess nematode diversity but requires universal primers with high taxonomic coverage and high taxonomic resolution. Several primers have been proposed for the metabarcoding of nematode diversity, many of which target the 18S rRNA gene. In silico analyses have a great potential to assess key parameters of primers, including taxonomic coverage, resolution and specificity. Based on a recently-available reference database, we tested in silico the performance of fourteen commonly used and one newly optimized primer for nematode metabarcoding. Most primers showed very good coverage, amplifying most of the sequences in the reference database, while four markers showed limited coverage. All primers showed good taxonomic resolution. Resolution was particularly good if the aim was the identification of higher-level taxa, such as genera or families. Overall, species-level resolution was higher for primers amplifying long fragments. None of the primers was highly specific for nematodes as, despite some variation, they all amplified a large number of other eukaryotes. Differences in performance across primers highlight the complexity of the choice of markers appropriate for the metabarcoding of nematodes, which depends on a trade-off between taxonomic resolution and the length of amplified fragments. Our in silico analyses provide new insights for the identification of the most appropriate primers, depending on the study goals and the origin of DNA samples. This represents an essential step to design and optimize metabarcoding studies assessing nematode diversity.

show abstract

18S-NemaBase: Curated 18S rRNA Database of Nematode Sequences

Cited by 10 publications

References 79 publications

Local climate modulates the development of soil nematode communities after glacier retreat

Local climate modulates the development of soil nematode communities after glacier retreat

A set of nematode rRNA cistron databases and a primer assessment tool to enable more flexible and comprehensive metabarcoding

In silico assessment of 18S rDNA metabarcoding markers for the characterization of nematode communities

Contact Info

Product

Resources

About