[33] First-strand cDNA synthesis primed with oligo(dT)

Krug, Marc S.; Berger, Shelby L.

doi:10.1016/0076-6879(87)52036-5

Cited by 196 publications

(78 citation statements)

References 7 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…24 cDNA synthesis 25 was performed starting with 1 g RNA, after heating for 10 min at 65°C. RanAlthough several stromal cell lines have the ability to support short-term blood formation they differ in their ability to supdom hexamer primers were used to ensure all RNA was represented equally in the cDNA pool.…”

Section: Resultsmentioning

confidence: 99%

Does transmembrane communication through gap junctions enable stem cells to overcome stromal inhibition?

et al. 1997

View full text Add to dashboard Cite

ronectin on stromal cells. 11 Lipophilic compounds that do not affect GJIC had no effect onWe asked if the gap junctions which are present in haemo- drugs (Ref. 13 and Krenács and Rosendaal, in preparation).Keywords: blood formation; haemopoietic regulation; gap junctions; Cx43; Amphotericin B; stem cells; stroma Gap junctions are intramembranous channels through the walls of adjacent cells which permit the passage of watersoluble molecules smaller than 1 kDa, which could be messengers. Channels are gated, open when cytosolic [Ca 2+ i ] is Introduction high or pH low and closed when the opposite conditions occur. A single gap junction channel is called a connexon Normally blood cells form only in those parts of the body, and is formed by two hemi-connexons, one in each cell wall. especially bone marrow, where specialised cells calledThe channels group into plaques and these are the functional haemopoietic stromal cells are found. Grafting these cells into gap junctions. Each hemi-connexon is formed by six identical, non-medullary tissues such as the kidney enables such tissues membrane-spanning proteins called connexins. Thirteen conto form blood. 1 We have been able to understand many nexin species have been described and named for their molaspects of lifelong blood formation supported by stromal cells ecular weights in thousands, abbreviated as Cx43, etc. 15 Cerusing long-term bone marrow cultures. 2 tain kinds of stromal cell in haemopoietic tissue are coupled It was thought that long-term cultures required an underlyby Cx43 gap junctions, but we do not know yet if that is the ing monolayer of adherent bone marrow stromal cells to form only connexin species that can form haemopoietic junctions. blood cells for a long time. Bentley 3 indicated that stroma and There are functional gap junctions in long-term cultures stem cells need only be close for the maintenance of spleen between stromal and haemopoietic cells. 12 To investigate a colony-forming units and Brandt and colleagues 4 found that possible role of gap junctions in the regulation of haemopothe underlay could be replaced by adding recombinant iesis we studied the numerical alterations in clone formation interleukins IL-1 alpha, IL-3, IL-6, or granulocyte-macrophage and progenitor cell generation in stroma-supported long-term colony-stimulating factor (GM-CSF) at 2-day intervals. IL-3 cultures 2,[16][17][18] in the presence of lipophilic substances which block GJIC. Absolute numbers of haemopoietic clones were estimated using the cobblestone area forming cell (CAFC) culture carried out in a limited dilution set-up. In the mouse

show abstract

Section: Resultsmentioning

confidence: 99%

Does transmembrane communication through gap junctions enable stem cells to overcome stromal inhibition?

et al. 1997

View full text Add to dashboard Cite

show abstract

“…These samples, which contain the complete cellular complement of mRNA, were also utilized for simultaneously quantifying transcripts from endogenous and transfected prothymosin ␣ genes by linked reverse transcriptase PCR (RT-PCR). In these preparations, oligo(dT) [12][13][14][15][16][17][18] served as a primer in the RT step (35), whereas three primers-GCTCTCCACCACCCAACCCAAACC ATG targeted upstream of the ScaI site (Fig. 1A), CCACAAGTAAAGTCA GAAGTAGGACAGAGAACGC directed at genomic sequences downstream of the ScaI site, and GCTCTTTCAAAGGTTTTATTCATTGC aimed at the insulin sequences found in the pPTMA plasmids-were acquired for the PCR step.…”

Section: Methodsmentioning

confidence: 99%

Do Products of the myc Proto-Oncogene Play a Role in Transcriptional Regulation of the Prothymosin α Gene?

Mol

Wang

Batey

et al. 1995

Molecular and Cellular Biology

View full text Add to dashboard Cite

The Myc protein has been reported to activate transcription of the rat prothymosin ␣ gene by binding to an enhancer element or E box (CACGTG) located in the first intron (S. Gaubatz et al., Mol. Cell. Biol. 14:3853-3862, 1994). The human prothymosin ␣ gene contains two such motifs: in the promoter region at kb ؊1.2 and in intron 1, ϳ2 kb downstream of the transcriptional start site in a region which otherwise bears little homology to the rat gene. Using chloramphenicol acetyltransferase (CAT) reporter constructs driven either by the 5-kb human prothymosin ␣ promoter or by a series of truncated promoters, we showed that removal of the E-box sequence had no effect on transient expression of CAT activity in mouse L cells. When intron 1 of the prothymosin ␣ gene was inserted into the most extensive promoter construct downstream of the CAT coding region, a diminution in transcription, which remained virtually unchanged upon disruption of the E boxes, was observed. CAT constructs driven by the native prothymosin ␣ promoter or the native promoter and intron were indifferent to Myc; equivalent CAT activity was observed in the presence of ectopic normal or mutant Myc genes. Similarly, expression of a transiently transfected wild-type prothymosin ␣ gene as the reporter was not affected by a repertoire of myc-derived genes, including myc itself and dominant or recessive negative myc mutants. In COS-1 cells, equivalent amounts of the protein were produced from transfected prothymosin ␣ genes regardless of whether genomic E boxes were disrupted, intron 1 was removed, or a repertoire of myc-derived genes was included in the transfection cocktail. More importantly, cotransfection of a dominant negative Max gene failed to reduce transcription of the endogenous prothymosin ␣ gene in COS cells or the wild-type transfected gene in COS or L cells. Taken together, the data do not support the idea that Myc activates transcription of the intact human prothymosin ␣ gene or reporter constructs that mimic its structure. Rather, they suggest that the human prothymosin ␣ promoter and downstream elements are buffered so as to respond poorly, if at all, to transient fluctuations in transcription factors which regulate other genes.

show abstract

“…RNA was isolated either by ultracentrifugation on CsCl gradients or with TRIzol (Life Technologies, Grand Island, NY), and first-strand cDNA was synthesized using oligo(dT) as a primer (27). The VDJ-C genes were PCR amplified from the cDNA by using primers specific for exon 1 of C (24) and a conserved region in the V H leader (28).…”

Section: Nucleotide Sequences Of Vdj Genesmentioning

confidence: 99%

Intestinal Microflora and Diversification of the Rabbit Antibody Repertoire

Lanning

Sethupathi

Rhee

et al. 2000

The Journal of Immunology

View full text Add to dashboard Cite

The rabbit establishes its primary Ab repertoire by somatically diversifying an initial repertoire that is limited by restricted V H gene segment usage during VDJ gene rearrangement. Somatic diversification occurs in gut-associated lymphoid tissue (GALT), and by about 1-2 mo of age nearly all Ig VDJ genes are somatically diversified. In other species that are known to establish their primary Ab repertoire by somatic diversification, such as chicken, sheep, and cattle, diversification appears to be developmentally regulated: it begins before birth and occurs independent of exogenous factors. Because somatic diversification in rabbit occurs well after birth in GALT, the diversification process may not be developmentally regulated, but may require interaction with exogenous factors derived from the gut. To test this hypothesis, we examined Ab repertoire diversification in rabbits in which the appendix was ligated shortly after birth to prevent microbial colonization and all other organized GALT was surgically removed. We found that by 12 wk of age nearly 90% of the Ig VDJ genes in PBL were undiversified, indicating that intestinal microflora are required for somatically diversifying the Ab repertoire. We also examined repertoire diversification in sterilely derived remote colony rabbits that were hand raised away from contact with conventional rabbits and thereby acquired a different gut microflora. In these remote colony rabbits, GALT was underdeveloped, and 70% of the Ig VDJ genes in PBL were undiversified. We conclude that specific, currently unidentified intestinal microflora are required for Ab repertoire diversification. The Journal of Immunology, 2000, 165: 2012-2019.T he rabbit is one of a few vertebrate species known to make limited use of combinatorial joining of multiple V H, D H , and J H gene segments during Ig heavy chain gene rearrangement. Although there are more than 100 V H gene segments available within the rabbit Ig heavy chain locus, many of which appear to be potentially functional (1), the 3Ј-most V H gene segment, V H 1, is utilized in 80 -90% of VDJ gene rearrangements (2). Most of the remaining 10 -20% of VDJ gene rearrangements utilize only two other V H gene segments, V H x and V H y (3). Rabbit B cells diversify their VDJ genes in gut-associated lymphoid tissue (GALT) 4 at 1-2 mo of age through two targeted mutational processes: a somatic gene conversion-like mechanism that transfers tracts of nucleotide sequence from upstream V H gene segment donors into the rearranged V H gene segment (4), and somatic hypermutation that distributes point mutations throughout the entire VDJ gene (5-7). At that time, the B cell population is also expanded through proliferation in GALT. B cell proliferation and Ig VDJ gene diversification in GALT results in a large population of B cells that express a wide range of Ab specificities.Several studies have established the importance of GALT in B cell proliferation and VDJ gene diversification. Weinstein et al. (7), for example, determined VDJ gene nucleotide...

show abstract

[33] First-strand cDNA synthesis primed with oligo(dT)

Cited by 196 publications

References 7 publications

Does transmembrane communication through gap junctions enable stem cells to overcome stromal inhibition?

Does transmembrane communication through gap junctions enable stem cells to overcome stromal inhibition?

Do Products of the myc Proto-Oncogene Play a Role in Transcriptional Regulation of the Prothymosin α Gene?

Intestinal Microflora and Diversification of the Rabbit Antibody Repertoire

Contact Info

Product

Resources

About