4-Acetyl-antroquinonol B Suppresses SOD2-Enhanced Cancer Stem Cell-Like Phenotypes and Chemoresistance of Colorectal Cancer Cells by Inducing hsa-miR-324 Re-Expression

SOD2 acetylation and deacetylation: Another tale of Jekyll and Hyde in cancer

“…Thus, understanding how CSC function and survival are controlled is important. In PNAS, He et al (10) extend previous findings (11,12) and further establish a causal relationship between manganese superoxide dismutase (SOD2) overexpression and CSC formation, and provide a mechanism that explains this association involving acetylated SOD2, increased mitochondrial H 2 O 2 , and HIF2α expression.…”

LncRNA ANRIL Regulates Ovarian Cancer Progression and Tumor Stem Cell-Like Characteristics via miR-324-5p/Ran Axis

“…Q-PCR assay was conducted by SuperScript III Platinum SYBR Green One-Step qPCR kit and mirVana™ qRT-PCR miRNA Detection Kit (Thermo Fisher Scientific). The primers sequences were: ANRIL: F, 5ʹ- GGAACCAAGCAGACCGAAGAC −3ʹ, R, 5ʹ- CCCCAACCCACAGGAACATAA −3ʹ; miR-324-5p: F, 5ʹ- CGCGGATCCGGGTGGATGTAAGGGATGAG-3ʹ, R, 5ʹ- CCGGAATTCTTGGGCTGATCCAGGAGAAG-3ʹ; 14 Ran: F, 5ʹ-TGGCTTGCTAGGAAGCTCAT-3ʹ, R: 5ʹ- CACCGCTGACATCACAGGAC-3ʹ; β-actin: F, 5ʹ-GACCTCTATGCCAACACAGT-3ʹ, R, 5ʹ-AGTACTTGCGCTCAGGAGG-3ʹ. 15 The relative gene expression was obtained using the 2 −ΔΔCt method by normalizing to β-actin or U6.…”

Epithelial-Mesenchymal Transition and MicroRNAs in Colorectal Cancer Chemoresistance to FOLFOX

“…Upregulation of glycerophosphodiester phosphodiesterase domain containing 5 (GDPD5, an enzyme that participates in glycerol metabolism), superoxide dismutase 2 (SOD2, involved in superoxide radicals detoxification), and heat shock protein beta-1 (Hsp27, a chaperone involved in cellular stress-response), occurs in several CRC samples and colon cancer cell lines. MiR-195-5p [ 53 ], miR-324-5p [ 54 ], and miR-214 [ 49 ] target GDPD5, SOD2, and Hsp27, respectively. Moreover, downregulation of GDPD5 and SOD2 by these miRs or by small interfering RNAs also reverse EMT in colon cancer cell lines in vitro [ 53 , 54 ].…”