8S Globulin of Mungbean [Vigna radiata (L.) Wilczek]:  Cloning and Characterization of Its cDNA Isoforms, Expression in Escherichia coli, Purification, and Crystallization of the Major Recombinant 8S Isoform

Abstract

Three isoforms of the cDNA of the major 8S globulin of mungbean, 8Salpha, 8Salpha', and 8Sbeta, were isolated, cloned, and characterized. The cDNA sequences of 8Salpha, 8Salpha', and 8Sbeta had open reading frames of 1362, 1359 or 1362, and 1359 bp, respectively, which code for 454, 453 or 454, and 453 amino acids corresponding to molecular weights of 51 973, 51 627 or 51 758, and 51 779, respectively. Homology in terms of cDNA and amino acid sequences was 91-92% between 8Salpha and 8Salpha', 87% between 8Salpha and 8Sbeta, and 86-88% between 8Salpha' and 8Sbeta. The signal peptide was found to be 1-25, 1-24 or 25, and 1-23 for 8Salpha, 8Salpha', and 8Sbeta, respectively, using the signalP website (Nielsen, H.; Engelbrecht, J.; Brunak, S.; von Heijne, G. Protein Eng. 1997, 10, 1-6). The propeptide was determined to be IVHREN. A single site for glycosylation (N-X-S/T) was observed about 90 amino acids from the C terminus. Homology between mungbean 8S isoforms and other 7-8S proteins ranged from 45 to 68% within members of the legume family and 29 to 34% for crops of different species. The major isoform 8Salpha was expressed in Escherichia coli and purified by successive ammonium sulfate fractionation, hydrophobic interaction, and Mono Q column chromatography. The recombinant 8Salpha, but not the native form, was successfully crystallized producing rhombohedral crystals.

Introduction of sulfhydryl groups and disulfide linkage to mungbean 8Sα globulin and effects on physicochemical and functional properties

“…1) were replaced with cysteine residues by the use of a QuickChange site-directed mutagenesis kit (Stratagene, U.S.A.) and mutation sites were confirmed by DNA sequencing. The plasmid pET-21d-8Sα globulin, which is the expression vector for WT (Bernardo et al, 2004), was used as a template. The primers used were for F59C (Phe59→ Cys59): 5′CCGTGTTGTTAGAGTGCATGTCCAAACCC3′ and 5′ GGGTTTGGACATTGCACTCTACAACACGG3′; for I99C (Ile99 → Cys99): 5′GGCAGAGACTCCACCTGCCTTGAGCAAGGCCATG3′ and 5′CATGGCCT TGCTCAAGGCAGTTGGAGTCTCTGCC3′; for A213C (Ala213→ Cys213): 5′GGGAATTGACCAAACATTGCAAATCTAGTTCAAAG3′ and 5′CTTTGAAC-TAGATTTGCAATGTTTGGTCAATTCCC3′ (mutations are indicated by underlined letters).…”

“…In designing the mutation, we used the soybean proglycinin structure as basis since the amino acid sequences of proglycinin A1aB1b and 8Sα globulin had 68% identity which is the highest among other 7S, 8S globulins (Bernardo et al, 2004;Itoh et al, 2006). Earlier work has shown that the soybean proglycinin A1aB1b mutant proteins with new cysteine residues and disulfide bonds (intraprotomer or interprotomer) were improved in their heat-induced gel-forming ability and were more stable than the wild type against thermal denaturation and with greater resistance against chymotrypsin digestion .…”

“…We have studied the storage proteins of mungbean extensively (Bernardo et al, 2004;Garcia, Adachi, Tecson-Mendoza, Bernardo, & Utsumi, 2006;Itoh et al, 2006;Tecson-Mendoza, Adachi, Bernardo, & Utsumi, 2001) towards our goal to improve their nutritional and functional properties. In mungbean, the 8S globulins are the major storage proteins (89%) followed by the legumin type or 11S (7.6%) and the basic 7S (3.4%) (Tecson-Mendoza et al, 2001).…”

“…We have successfully introduced methionine into mungbean's major 8S α globulin by protein engineering and characterized the modified Met rich proteins (Torio et al, 2011). Since the mungbean 8S globulins do not have cysteine groups or disulfide linkages (Bernardo et al, 2004), it may be possible to improve their functional properties by the introduction of sulfhydryl groups and disulfide linkage by protein engineering.…”

Vicilin Genes of Vigna luteola: Structure, Organization, Expression, and Variation

“…Surprisingly, in V. luteola, all of the sulfur is contributed by methionine; there are no cysteine residues. Predicted proteins of vicilins of V. angularis (Fukuda et al 2007), V. radiata (Bernardo et al 2004), and V. unguiculata (GenBank AM905848) also contain no cysteine, and neither does the Ph. vulgaris vicilin.…”