A Chinese patient with 11β-hydroxylase deficiency due to novel compound heterozygous mutation in CYP11B1 gene: a case report

Abstract

BackgroundCongenital adrenal hyperplasia (CAH) resulting from steroid 11β-hydroxylase deficiency (11β-OHD) is caused by mutations in the CYP11B1 gene. It is the second major form of CAH associated with hypertension and hypopotassemia. The aim of this study was to provide a genetic analysis of 11β-OHD in a Chinese family.Case presentationA 19-year-old Chinese man was clinically diagnosed with 11β-OHD. His initial clinical manifestations included precocious puberty, hyperpigmentation, hypertension, and hypopotassemia. The patient had taken an overdose of dexamethasone (0.75 mg/d) for more than 10 years before finally developing iatrogenic Cushing’s syndrome. Our aim was to perform a molecular diagnosis of his family. Mutations in the CYP11B1 gene of the patient and his parents were examined using polymerase chain reaction (PCR) resequencing. Additionally, to predict the possible effects of novel mutations on the structure and function of 11β-hydroxylase, these mutations were analyzed by MutationTaster software. Two novel pathogenic mutations were found in the CYP11B1 gene: a heterozygous in-frame insertion deletion mutation c.1440_1447delinsTAAAAG in exon 9 inherited from the father and a heterozygous mutation c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC (p.364_372del) in exon 6 inherited from the mother.ConclusionsA clear genetic diagnosis can be made by analyzing the functional and structural consequences of CYP11B1 gene mutations that lead to 11β-OHD. Because the dosage of glucocorticoid should be adjusted to minimize the risk of iatrogenic Cushing’s syndrome, clinical follow-up should be conducted with these patients.Electronic supplementary materialThe online version of this article (10.1186/s12902-018-0295-6) contains supplementary material, which is available to authorized users.

Genetic variants in CYP11B1 influence the susceptibility to coronary heart disease

“…The 11β-hydroxylase ( CYP11B1 ) gene is located on chromosome 8q24.3, contains 9 exons and 8 introns, and consists of 503 amino acids [ 10 ]. It is a key enzyme responsible for the final step in cortisol biosynthesis [ 11 ].…”

“…The genotypes of the CYP11B1 / CYP11B2 loci are in strong linkage disequilibrium [ 12 ]. The two synthesize 11β hydroxylase and aldosterone synthase, and then synthesize steroids, which play an important role in myocardial fibrosis, hypertension and arteriosclerosis [ 10 , 13 ]. Studies have shown that steroid metabolism induces the development of coronary artery disease [ 14 ].…”

Current Aspects of Genetic Diagnosis of 21-Hydroxylase Insufficiency

“…Более чем в 95% случаев причиной ВДКН является недостаточность фермента 21-гидроксилазы. На втором месте находится гипертоническая форма ВДКН, которая проявляется при дефиците 11β-гидроксилазы и встреча-ется, по данным литературы, примерно у 1 из 100 000 новорожденных [2].…”