A DNA polymerase with unusual properties from the slime mold Physarum polycephalum

Abstract

Two forms of a DNA polymerase have been purified from microplasmodia of Physarurn polycephalurn by poly(ethy1eneimine) precipitation and chromatography on DEAE-Sephacel, phosphocellulose, heparin Sepharose, hydroxyapatite, DNA-agarose, blue-Sepharose. They were separated from DNA polymerase CI on phosphocellulose and from each other on heparin-Sepharose. Form HS1 enzyme was 30-40% pure and form HS2 enzyme 60% with regard to protein contents of the preparations. Form HS2 enzyme was generated from form HSI enzyme on prolonged standing of enzyme preparations. The DNA polymerases were obtained as complexes of a 60-kDa protein associated with either a 135-kDa (HS1) or a 110-kDa (HS2) DNA-polymerizing polypeptide in a 1 : 1 molar stoichiometry. The biochemical function of the 60-kDa protein remained unknown. The complexes tended to dissociate during gradient centrifugation and during partition chromatography as well as during polyacrylamide gradient gel electrophoresis under nondenaturing conditions at high dilutions of samples. Both forms existed in plasmodia extracts, their proportions depending on several factors including those which promoted proteolysis.The DNA polymerases resembled eucaryotic DNA polymerase p by several criteria and were functionally indistinguishable from each other. It is suggested that lower eucaryotes contain repair DNA polymerases, which are similar to those of eubacteria on a molecular mass basis.DNA polymerases of Physarurn polycephalum are of interest because (a) this organism is phylogenetically on the border between eucaryotes and procaryotes, and could therefore contain novel forms of DNA polymerases, and (b) Physarum macroplasmodia execute a naturally synchronous nuclear division (of more than lo8 nuclei/cell) making it an ideal model for cell cycle investigations [l].Recent studies [2 -51, however, have revealed considerable difficulties in obtaining and characterizing these DNA polymerases, probably due to interfering proteolysis and uncontrollabe factors in growing Physarurn microplasmodia. We have reinvestigated purification, during which we have monitored types of DNA polymerases as well as their molecular masses, and have used a newly developed combination of gradient gel electrophoresis with a DNA polymerase overlay assay (61. The method is less disruptive of weak complexes than, for instance, gel permeation chromatography. We report the characterization of a DNA polymerase which does not resemble any of those of higher eucaryotes. Correspondence to

Biological and biosynthetic properties of poly-l-malate

“…Panel A, Nuclear extracts of microplasmodia. (------) PMA in the absence of 14C-PMA, ( ) DNA synthesis activity (the band at 240 kDa represents /3-like, DNA polymerase [9], which does not bind PMA), ( ...... ) absorbance at 230 nm wavelength, (e) ]4C-PMA (62 kDa corr. molecular mass) at an amount approx, equal to that of endogenous PMA, added to the nuclei shortly before lysis, (*,) as before, but at approx.…”

The DNA‐polymerase inhibiting activity of poly(β‐l‐malic acid) in nuclear extract during the cell cycle of Physarum polycephalum

“…DNA polymerase α (110 U·mL −1 ) was purified from plasmodia as described previously [11]. DNase‐Ι‐activated salmon testis DNA for the standard DNA polymerase assay and for photoaffinity labeling was prepared as described previously [12]. Rabbit antiserum against DNA polymerases type α and type ε, was prepared with a mixture of the purified P. polycephalum DNA polymerases [13], and rabbit antiserum against DNA polymerase δ by immunization with synthetic peptides of the enzyme [6].…”

“…Total DNA polymerase activity was assayed as described previously [12]. The standard assay contained in 150 lL 50 mM 3-(N-morpholino)propanesulfonic acid/potassium salt (pH 7.5), 50 mM KCl, 10 mM MgCl 2 , 3 mM EDTA, 3 mM 2-mercaptoethanol, 33 lM each of dATP, dCTP, dGTP, 3 lM [ 3 H]dTTP (1 CiAEmmol )1 ), 20 lg DNase-I activated salmon testis DNA, 80 lg bovine serum albumin, and DNA polymerase.…”

Molecular constituents of the replication apparatus in the plasmodium of Physarum polycephalum: identification by photoaffinity labelling

“…according to Holler et al (1987). Synthetic 16-mer primer 5' GTTTTCCCAGTCACGA 3' was annealed to a synthetic 26- mer template 3' CAAAAGGGTCAGTGCTGTTAACCTAC 5' or to M13mpl8 DNA 3 / ...CAAAAGGGTCAGTGCTGC- AACATTTTGCT...5' (annealed bases underlined).…”

“…The activities of DNA polymerases were routinely standardized by assaying acid- precipitable radioactivity incorporated into DNA synthesized from [α- 32 P]dTTP as substrate. For DNA polymerase α, DNase-I-activated salmon testis DNA was used as template- primer (Holler et al, 1987), and for DNA polymerases δ and ε, poly(dA)/p(dT) 12 _ 18 (Achhammer et al, 1995). One unit of enzyme activity represents the incorporation of 1 nmol bases during 1 h at 37 °C in the standard assay.…”