A Dominant Allele of Arabidopsis Pectin-Binding Wall-Associated Kinase Induces a Stress Response Suppressed by MPK6 but Not MPK3 Mutations

Abstract

The plant cell wall is composed of a matrix of cellulose fibers, flexible pectin polymers, and an array of assorted carbohydrates and proteins. The receptor-like Wall-Associated Kinases (WAKs) of Arabidopsis bind pectin in the wall, and are necessary both for cell expansion during development and for a response to pathogens and wounding. Mitogen Activated Protein Kinases (MPKs) form a major signaling link between cell surface receptors and both transcriptional and enzyme regulation in eukaryotes, and Arabidopsis MPK6 and MPK3 indeed have important roles in development and the response to stress and pathogens. A dominant allele of WAK2 requires kinase activity and activates a stress response that includes an increased ROS accumulation and the up-regulation of numerous genes involved in pathogen resistance, wounding, and cell wall biogenesis. This dominant allele requires a functional pectin binding and kinase domain, indicating that it is engaged in a WAK signaling pathway. A null mutant of the major plasma membrane ROS-producing enzyme complex, rbohd/f does not suppress the WAK2cTAP-induced phenotype. A mpk6, but not a mpk3, null allele is able to suppress the effects of this dominant WAK2 mutation, thus distinguishing MPK3 and MPK6, whose activity previously was thought to be redundant. Pectin activation of gene expression is abated in a wak2-null, but is tempered by the WAK-dominant allele that induces elevated basal stress-related transcript levels. The results suggest a mechanism in which changes to the cell wall can lead to a large change in cellular responses and help to explain how pathogens and wounding can have general effects on growth.

Requirement for Pectin Methyl Esterase and Preference for Fragmented over Native Pectins for Wall-associated Kinase-activated, EDS1/PAD4-dependent Stress Response in Arabidopsis

“…Plant Growth-Arabidopsis thaliana Columbia was grown on soil or agar plates as described (21), at 22°C, 16 h of light, 8 h of dark. For comparison within an experiment, triplicate samples grown at the same time were used.…”

“…Quantitative PCR was as described (21,28); 1 g of RNA was used for a reverse transcription assay using oligo(dT) for first-strand synthesis in an Invitrogen Superscript III RT-PCR kit (Invitrogen catalog no. 18080-051).…”

“…21 and using primers listed in Table 1 and the following general T-DNA primers: p745, AACGTCCGCAATGTGTTATTA-AGTTG; MLB1, GTGGACTCTTGTTCCAAACTG; LBb1.3, ATTTTGCCGATTTCGGAAC; LBa1, TGGTTCACGTAG-TGGGCCATC.…”

“…Notably, and in parallel to the two pectin types, WAKs have been assigned two distinct roles, one in cell expansion in seedlings (20) and another in a response to OGs generated by pathogens (21)(22)(23). During seedling growth, WAKs are required for cell expansion and have been shown to be involved in the pectin activation of MPK3 and a vacuolar invertase that can increase turgor-driven expansion (17,20).…”

“…A dominant gain of function WAK2 allele, WAK2cTAP, consti-tutively activates a MPK6-dependent stress response in Arabidopsis, and this response also requires pectin binding by WAK (17,21). Thus, a native pectin-based expansion response and the OG-activated stress response are distinguished by, on the one hand, the activation of MPK3 and invertase and, on the other, by MPK3 and MPK6 and stress-related proteins, respectively.…”