A dominant negative variant of
            <i>RAB5B</i>
            disrupts maturation of surfactant protein B and surfactant protein C

Huang, Huiyan; Pan, Jiehong; Spielberg, D.R.; Hanchard, Neil A.; Scott, Daryl A.; Burrage, Lindsay C.; Dai, Hongzheng; Murdock, David R.; Rosenfeld, Jill A.; Mohammad, Ariz; Huang, Tao; Lindsey, Anika; Kim, Hyori; Chen, Jian; Ramu, Avinash; Morrison, Stephanie A.; Dawson, Zachary; Hu, A.; Tycksen, Eric; Silverman, Gary A.; Baldridge, Dustin; Wambach, Jennifer A.; Pak, Stephen C.; Brody, Steven L.; Schedl, Tim

doi:10.1073/pnas.2105228119

Cited by 20 publications

(16 citation statements)

References 63 publications

(61 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…First, we assessed the consequences of the variants when present in the homozygous state. Worms homozygous for A29P, Q78R and D135N were lethal at the first larval (L1) stage, indistinguishable from the L1 lethal phenotype of the rab-5 homozygous deletion allele ok2605 ( 25 ). Interestingly, when modeling the mildest patient variant, rab-5 M127N homozygotes were viable and fertile but exhibited cold-sensitive phenotypes including slower growth, reduced adult body length and reduced crawling speed ( Supplementary Material, Fig.…”

Section: Resultsmentioning

confidence: 99%

Macrocephaly and developmental delay caused by missense variants in RAB5C

Koop

Yuan

Tessadori

et al. 2023

Human Molecular Genetics

View full text Add to dashboard Cite

Rab GTPases are important regulators of intracellular vesicular trafficking. RAB5C is a member of the Rab GTPase family that plays an important role in the endocytic pathway, membrane protein recycling and signaling. Here we report on 12 individuals with 9 different heterozygous de novo variants in RAB5C. All but one patient with missense variants (n = 9) exhibited macrocephaly, combined with mild to moderate developmental delay. Patients with loss of function variants (n = 2) had an apparently more severe clinical phenotype with refractory epilepsy and intellectual disability, but a normal head circumference. Four missense variants were investigated experimentally. In vitro biochemical studies revealed that all four variants were damaging, resulting in increased nucleotide exchange rate, attenuated responsivity to guanine exchange factors, and heterogeneous effects on interactions with effector proteins. Studies in C. elegans confirmed that all four variants were damaging in vivo and showed defects in endocytic pathway function. The variant heterozygotes displayed phenotypes that were not observed in null heterozygotes, with two shown to be through a dominant negative mechanism. Expression of the human RAB5C variants in zebrafish embryos resulted in defective development, further underscoring the damaging effects of the RAB5C variants. Our combined bioinformatic, in vitro and in vivo experimental studies and clinical data support the association of RAB5C missense variants with a neurodevelopmental disorder characterized by macrocephaly and mild to moderate developmental delay through disruption of the endocytic pathway.

show abstract

Section: Resultsmentioning

confidence: 99%

Macrocephaly and developmental delay caused by missense variants in RAB5C

Koop

Yuan

Tessadori

et al. 2023

Human Molecular Genetics

View full text Add to dashboard Cite

show abstract

“…pph-5(udn90-94) alleles were generated by injecting VC2010 1 day adults with Cas9 (IDT 1081060), tracrRNA (IDT 1072533), crRNA with the targeting sequence TGCAGATCAAGTGTACGACG (IDT Alt-R ® CRISPR-Cas9 sgRNA), pRF4 rol-6 plasmid as a positive injection marker, and single-stranded DNA oligonucleotide repair template (IDT) as previously described [32, 33]. Repair templates were 100 bases in length, centering on the locus of the proband variant, and were used to destroy the PAM site to prevent further editing, add a silent AvaII (NEB R0153L) restriction site to aid in genotyping, and to introduce the proband variant.…”

Section: Methodsmentioning

confidence: 99%

“…This gene has not previously been associated with a Mendelian disease. Therefore, we evaluated this gene-variant by performing in vivo functional analysis in the model organism C. elegans, as has been performed for other genes of uncertain significance [32][33][34]. We employed CRISPR-Cas9 to introduce the proband's missense variant into pph-5, the C. elegans ortholog of PPP5C, and assessed the impact of pph-5 Ala48Thr, corresponding to human PPP5C p.Ala47Thr.…”

Section: Introductionmentioning

confidence: 99%

Functional analysis of a novel de novo variant in PPP5C associated with microcephaly, seizures, and developmental delay

Fielder

Rosenfeld

Burrage

et al. 2022

Preprint

Self Cite

View full text Add to dashboard Cite

We describe a proband evaluated through the Undiagnosed Diseases Network (UDN) who presented with microcephaly, developmental delay, and refractory epilepsy with a de novo p.Ala47Thr missense variant in the protein phosphatase gene, PPP5C. This gene has not previously been associated with a Mendelian disease, and based on the population database, gnomAD, the gene has a low tolerance for loss-of-function variants (pLI=1, o/e=0.07). We functionally evaluated the PPP5C variant in C. elegans by knocking the variant into the orthologous gene, pph-5, at the corresponding residue, Ala48Thr. We employed assays in three different biological processes where pph-5 was known to function through opposing the activity of genes, mec-15 and sep-1. We demonstrated that, in contrast to control animals, the pph-5 Ala48Thr variant suppresses the neurite growth phenotype and the GABA signaling defects of mec-15 mutants, and the embryonic lethality of sep-1 mutants. The Ala48Thr variant did not display dominance and behaved similarly to the reference pph-5 null, indicating that the variant is likely a strong hypomorph or complete loss-of-function. We conclude that pph-5 Ala48Thr is damaging in C. elegans. By extension in the proband, PPP5C p.Ala47Thr is likely damaging, the de novo dominant presentation is consistent with haploinsufficiency, and the PPP5C variant is likely responsible for one or more of the proband's phenotypes.

show abstract

“…The resulting plasmid NM3933 was injected at 50 ng/μl into NM5340 jsSi1579 [loxP rpl-28p FRT GFP::his-58 FRT3] II; unc-119(ed3) III; bqSi711 [mex-5pFLP sl2 mNeon Green] IV. Three independent integrants were obtained as previously described [81]. After outcrossed twice with VC2010 to remove unc-119(ed3) III and bqSi711 [mex-5pFLP sl2 mNeon Green] IV, three single copy unc-116(+) transgene lines were generated.…”

Section: Modeling In C Elegansmentioning

confidence: 99%

“…elegans body length and swimming analysis. Body length and swimming speed were measured using the WormLab 2019.1.1 (MBF Bioscience) [81]. Briefly, about 30 late L4 stage worms per strain were transferred onto seeded NGM plates 24 hours before the assay.…”

Section: Plos Geneticsmentioning

confidence: 99%

Dominant negative variants in KIF5B cause osteogenesis imperfecta via down regulation of mTOR signaling

Marom,

Zhang,

Washington

et al. 2023

PLoS Genet

Self Cite

View full text Add to dashboard Cite

Background Kinesin motor proteins transport intracellular cargo, including mRNA, proteins, and organelles. Pathogenic variants in kinesin-related genes have been implicated in neurodevelopmental disorders and skeletal dysplasias. We identified de novo, heterozygous variants in KIF5B, encoding a kinesin-1 subunit, in four individuals with osteogenesis imperfecta. The variants cluster within the highly conserved kinesin motor domain and are predicted to interfere with nucleotide binding, although the mechanistic consequences on cell signaling and function are unknown. Methods To understand the in vivo genetic mechanism of KIF5B variants, we modeled the p.Thr87Ile variant that was found in two patients in the C. elegans ortholog, unc-116, at the corresponding position (Thr90Ile) by CRISPR/Cas9 editing and performed functional analysis. Next, we studied the cellular and molecular consequences of the recurrent p.Thr87Ile variant by microscopy, RNA and protein analysis in NIH3T3 cells, primary human fibroblasts and bone biopsy. Results C. elegans heterozygous for the unc-116 Thr90Ile variant displayed abnormal body length and motility phenotypes that were suppressed by additional copies of the wild type allele, consistent with a dominant negative mechanism. Time-lapse imaging of GFP-tagged mitochondria showed defective mitochondria transport in unc-116 Thr90Ile neurons providing strong evidence for disrupted kinesin motor function. Microscopy studies in human cells showed dilated endoplasmic reticulum, multiple intracellular vacuoles, and abnormal distribution of the Golgi complex, supporting an intracellular trafficking defect. RNA sequencing, proteomic analysis, and bone immunohistochemistry demonstrated down regulation of the mTOR signaling pathway that was partially rescued with leucine supplementation in patient cells. Conclusion We report dominant negative variants in the KIF5B kinesin motor domain in individuals with osteogenesis imperfecta. This study expands the spectrum of kinesin-related disorders and identifies dysregulated signaling targets for KIF5B in skeletal development.

show abstract

A dominant negative variant of RAB5B disrupts maturation of surfactant protein B and surfactant protein C

Cited by 20 publications

References 63 publications

Macrocephaly and developmental delay caused by missense variants in RAB5C

Macrocephaly and developmental delay caused by missense variants in RAB5C

Functional analysis of a novel de novo variant in PPP5C associated with microcephaly, seizures, and developmental delay

Dominant negative variants in KIF5B cause osteogenesis imperfecta via down regulation of mTOR signaling

Contact Info

Product

Resources

About