A druggable secretory protein maturase of Toxoplasma essential for invasion and egress

Abstract

Micronemes and rhoptries are specialized secretory organelles that deploy their contents at the apical tip of apicomplexan parasites in a regulated manner. The secretory proteins participate in motility, invasion, and egress and are subjected to proteolytic maturation prior to organellar storage and discharge. Here we establish that Toxoplasma gondii aspartyl protease 3 (ASP3) resides in the endosomal-like compartment and is crucially associated to rhoptry discharge during invasion and to host cell plasma membrane lysis during egress. A comparison of the N-terminome, by terminal amine isotopic labelling of substrates between wild type and ASP3 depleted parasites identified microneme and rhoptry proteins as repertoire of ASP3 substrates. The role of ASP3 as a maturase for previously described and newly identified secretory proteins is confirmed in vivo and in vitro. An antimalarial compound based on a hydroxyethylamine scaffold interrupts the lytic cycle of T. gondii at submicromolar concentration by targeting ASP3.

Modeling and resistant alleles explain the selectivity of antimalarial compound 49c towards apicomplexan aspartyl proteases

“…BM, binding mode. Of relevance, 49c targets selectively TgASP3 and not TgASP5 (Dogga et al, 2017), and concordantly, a comparison between TgASP5 and TgASP3 models highlights important differences in their active sites. This suggests that the cavity of these enzymes favors the binding of stretched molecules and thus this binding propensity may account for the specificity of these hydroxy-ethylamine derivatives toward PfPMIX, PfPMX, and TgASP3.…”

“…The RH strain was transfected with 40 lg of pT8ASPty-HX or pT8ASP3ty-F344Y-HX or pT8ASP3ty-F386Y-HX or pT8ASP3ty-F344/386Y-HX (generated by digesting pT8ASP3ty-F386Y-HX with BstXI/NsiI and then subcloning into digested pT8ASP3ty-F344Y-HX vector) linearized with NotI. Ku80 luciferase strain was generated by transfecting with circular 60 lg pT8CBG99-luciferase-HX plasmid (Dogga et al, 2017). Ku80 luciferase strain was generated by transfecting with circular 60 lg pT8CBG99-luciferase-HX plasmid (Dogga et al, 2017).…”

“…iKDASP3-Myc/Ble strain (Dogga et al, 2017) was transfected with 5 0 UPRT-pT8ASP3ty-3 0 UPRT (Dogga et al, 2017) or 5 0 UPRT-pT8ASP3ty-F344Y-3 0 UPRT or 5 0 UPRT-pT8ASP3ty-F386Y-3 0 UPRT or 5 0 UPRT-pT8ASP3ty-F344/386Y-3 0 UPRT (generated by digesting pT8ASP3ty-F344Y-HX or pT8ASP3ty-F386Y-HX or pT8ASP3ty-F344/386Y-HX plasmid with ApaI/NsiI and subcloned into digested 5 0 UPRT-pT8ASP3ty-3 0 UPRT vector) linearized with SpeI/NotI. Similarly, ASP3ty-F344C strain was generated by transfecting with a Cas9-YFP/CRISPR guide (guideF344, GTTCGGGACAGGACGTATTGA) along with TgASP3-F344C synthetic oligonucleotides in KI-ASP3ty parasites (Dogga et al, 2017). This Ku80 luciferase strain was transfected with a Cas9-YFP/ CRISPR guide (guideF386, GAGATGTTTCCGTGCATGTTG) targeting the third exon of endogenous TgASP3 (generated using Q5 sitedirected mutagenesis kit (NEB) along with 40 lg of TgASP3 wildtype or TgASP3-F386Y synthetic oligonucleotides to generate Ku80Luc or Ku80LucASP3F38Y strain, respectively.…”

“…The red/green invasion assay was as described previously (Dogga et al, 2017). Briefly, parasites were treated either with DMSO or 49c (25, 50, 100, 500 nM) in 6-well plates seeded with HFF monolayers for approximately for 36 h. Freshly egressed parasites which were released after complete lysis of this 6-well plate were inoculated on 24well plates with HFF monolayers and were allowed to settle for 15 min at 4°C.…”

“…degradation, while the endoplasmic reticulum PfPMV is implicated in the cleavage of proteins destined for export into the host cell. TgASP3 is phylogenetically related to PfPMIX and PfPMX, and members of this cluster act as maturases for microneme and rhoptry proteins, playing a crucial role in invasion and in egress in both parasites, respectively (Dogga et al, 2017;Nasamu et al, 2017;Pino et al, 2017). Both proteases are involved in the export of parasite proteins across the parasitophorous vacuole membrane into the host cell Hammoudi et al, 2015;Bedi et al, 2016).…”