A fast method for monitoring the colonization rate of lactobacilli in a meat model system

Veyrat, Ana; Miralles, M. C.; Pérez-Martı́nez, Gaspar

doi:10.1046/j.1365-2672.1999.00795.x

Cited by 44 publications

(30 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Cultures were grown overnight at 37˚C in MRS broth. The protocol used for DNA extraction was as described by Veyrat et al (1999). Purity of DNA was checked by determining the A 260/280 value and by agarose gel electrophoresis.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Significant differences between Lactobacillus casei subsp. casei ATCC 393T and a commonly used plasmid-cured derivative revealed by a polyphasic study

Acedo-Félix

Pérez-Martı́nez

2003

International Journal of Systematic and Evolutionary Microbiology

View full text Add to dashboard Cite

INTRODUCTIONStrains belonging to the species Lactobacillus casei can be isolated from very different environments, and some of them are now used as probiotics in commercial products. This species is currently involved in a serious controversy and is the subject of numerous taxonomic studies, because many strains previously characterized as L. casei show genotypic, phenotypic and phylogenetic differences when compared to the standing type strain of the species, L. casei subsp. casei ATCC 393 T (Mills & Lessel, 1973;Dellaglio et al., 1975Dellaglio et al., , 1991Dicks et al., 1996;Collins et al., 1989;Ferrero et al., 1996;Mori et al., 1997;Zhong et al., 1998;Chen et al., 2000;Felis et al., 2001).L. casei has been used in a number of pioneering studies on the physiology and genetics of the genus Lactobacillus. The type strain L. casei subsp. casei (L. casei) ATCC 393 T especially has been used in studies on the fermentation of glucose, lactose, citrate and pyruvate (Hegazi & Abo-Elanga, 1987;Palles et al., 1998), comparative studies on and molecular characterization of the enzyme L-lactate dehydrogenase (Gordon & Doelle, 1976;Hensel et al., 1977;Kim et al., 1991), characterization of an intracellular bglucosidase (Coullon et al., 1998), proteolytic activity (Hegazi & Abo-Elanga, 1987) and studies on the composition of the cell wall, antibiotic resistance and adherence factors (Billot-Klein et al., 1997;Pelletier et al., 1997). Also, the isolation and characterization of extrachromosomal genetic elements in the genus Lactobacillus was reported for the first time in strains of L. casei, such as ATCC 393 T , 61BG, 64H, ATCC 334, ATCC 4646 and ATCC 15820 T (Chassy et al., 1976;Chassy & Giuffrida, 1980;Lee-Wickner & Chassy, 1984, 1985. Flickinger et al. (1986) obtained a number of plasmid-cured derivatives from L. casei strains; among these, an ATCC 393 T variant cured of plasmid pLZ15 [ATCC 393 (pLZ15 2 )], which encodes a lactose permease and b-galactosidase, was found (Chassy & Alpert, 1989). Besides the added value of being a derivative of the standing type strain, this plasmid-cured strain showed a great potential for studies on lactose metabolism, as it still carried a second lactose-specific transport and hydrolysis system, the lactose phosphoenolpyruvate : phosphotransferase system (PTS) and a 6-phospho-b-galactosidase. It was soon shown by the same research laboratory that this strain was amenable to genetic transformation by electroporation (Chassy & Flickinger, 1987). From this point in time, L. casei ATCC 393 (pLZ15 2 ) became widely used in genetic and physiological studies on L. casei and it has been used for the characterization of lactose, glucose, xylose and sorbose transport and metabolism (Hemme et al., 1994; Veyrat et al.,Abbreviations: ARDRA, amplified rDNA restriction analysis; ITS, intergenic spacer sequence; L. casei, L. casei subsp. casei; RAPD analysis, random amplified polymorphic DNA.

show abstract

Section: Methodsmentioning

confidence: 99%

“…PCR for RAPD was carried out as described by Veyrat et al (1999). Four oligonucleotides were used for the RAPD, ArgDei (ACCYTRGAAGGYGGYGATGTB), FAD1 (GGWTTTATCKCAGC-WTTGG), ISS1Rev (GGATCCAAGACAACGTTTCAAA) and OPL5 (ACGCAGGCAC).…”

Section: Methodsmentioning

confidence: 99%

Significant differences between Lactobacillus casei subsp. casei ATCC 393T and a commonly used plasmid-cured derivative revealed by a polyphasic study

Acedo-Félix

Pérez-Martı́nez

2003

International Journal of Systematic and Evolutionary Microbiology

View full text Add to dashboard Cite

show abstract

“…Aliquots were removed from the suspension to prepare serial dilutions, which were spread on MRS agar plates to count lactobacillus viable cells and on trypone soya agar (Difco, Detroit, Mich.) plates to count staphylococci. In order to verify that only the inoculated L. sakei strains grew during the fermentation, 40 colonies from each viable cell counting experiment were randomly selected from the MRS agar plates, and their randomly amplified polymorphic DNA profiles were determined as previously described (37). The remaining homogenate was filtered through filter paper, and the filtrate was centrifuged at 12,000 ϫ g for 10 min at 4°C.…”

Section: Methodsmentioning

confidence: 99%

The Product of arcR , the Sixth Gene of the arc Operon of Lactobacillus sakei , Is Essential for Expression of the Arginine Deiminase Pathway

Zúñiga

Miralles

Pérez-Martı́nez

2002

Appl Environ Microbiol

View full text Add to dashboard Cite

Lactobacillus sakei is a lactic acid bacterium commonly used as a starter culture for dry sausage production and can utilize arginine via the arginine deiminase pathway. The arcABCTD cluster of L. sakei has been characterized, and transcriptional studies have shown that its expression is subject to carbon catabolite repression and induction by arginine. Downstream of arcD an additional gene has been found; this gene, arcR, codes for a putative regulatory protein of the Crp/Fnr family. Transcriptional studies have shown that arcR is coordinately transcribed with the remaining arc genes, and therefore, these genes constitute the arcABCTDR operon. Northern analysis also showed a complex pattern of transcripts, suggesting that processing and partial termination may play a role in regulation of the expression of individual genes of the operon. Inactivation of arcR led to arrest of transcription of the operon, indicating that the ArcR protein is essential for expression of the arc genes. The availability of this mutant made it possible to study whether the ability to utilize arginine affects the growth of L. sakei in meat fermentations. Under our experimental conditions, expression of arginine deiminase does not confer an obvious advantage to L. sakei, since the wild type and an arcR mutant strain displayed similar dynamics of growth.The microbiota associated with dry fermented sausages encompasses a variety of bacteria, mostly lactic acid bacteria (LAB) and members of the Micrococcaceae, and undergoes marked changes during sausage production. LAB play an essential role in the production of dry fermented sausages. LAB, which are usually present at low levels in raw meat, grow rapidly in freshly prepared sausages, and the changes resulting from their metabolic activity make a major contribution to the final characteristics of the product (14). A number of different preparations and procedures are used for to manufacture dry fermented sausages; notwithstanding this, Lactobacillus sakei and Lactobacillus curvatus are the prevalent LAB in dry fermented sausages (5,16,25,30,33), and selected strains are normally used as starter cultures (15).L. sakei is a facultatively heterofermentative LAB commonly found in plant material, meat, and fermented meat products (14). Unlike other facultatively heterofermentative lactobacilli, L. sakei can utilize arginine via the arginine deiminase (ADI) pathway (22). The ADI pathway comprises three reactions, which are catalyzed by ADI (EC 3.5.3.6), ornithine transcarbamoylase (EC 2.1.3.3), and carbamate kinase (EC 2.7.2.2), and converts arginine to ornithine, ammonia, and CO 2 , generating 1 mol of ATP per mol of arginine consumed. Previous studies have shown that genes encoding the proteins required for arginine catabolism in L. sakei are organized in a cluster (39). These studies showed that transcription of the pathway is repressed by glucose and is induced by arginine. Moreover, it has been shown that arginine enhances the survival of L. sakei in the stationary phase (4). Although argin...

show abstract

“…Single-base substitutions, or insertions and deletions, will alter primer annealing, causing differing RAPD profiles that can be used to estimate nucleotide diversity and divergence (3). An advantage of RAPD analysis is that it can be applied to any strain or species of a bacterial group without previous knowledge of that isolate (26). In addition, much smaller quantities of DNA are required, which is especially important when dealing with grampositive species.…”

mentioning

confidence: 99%

“…PCR-based technologies of this type produce high concentrations of DNA composing the amplicons, which eliminates the need for expensive data-imaging software. RAPD typing has been used successfully for the characterization of numerous organisms, including P. aeruginosa (1,21) (26), and E. coli (23).…”

mentioning

confidence: 99%

Typing and Subtyping of 83 Clinical Isolates Purified from Surgically Implanted Silicone Feeding Tubes by Random Amplified Polymorphic DNA Amplification

2002

View full text Add to dashboard Cite

In this study, 83 clinical isolates purified from biofilms colonizing 18 silicone gastrostomy devices (12 "buttons" and six tubes converted to skin level devices) were selected for subtype characterization utilizing genetic analysis. The tubes, previously used for feeding, remained in place for 3 to 47 months (mean, 20.0 months) in children ranging in age from 6 months to 17 years. Classification of specific microbes using random amplified polymorphic DNA (RAPD) analysis revealed genetic similarities and differences among isolates belonging to the same genus. Both gram-positive and -negative bacteria were investigated, including 2 isolates of Bacillus brevis, 4 isolates of Bacillus licheniformis, 2 isolates of Bacillus pumilus, 3 isolates of Enterococcus durans, 19 isolates of Enterococcus faecalis, 8 isolates of Enterococcus faecium, 2 isolates of Enterococcus hirae, 7 isolates of Escherichia coli, 8 isolates of Lactobacillus plantarum, 19 isolates of Staphylococcus aureus, 2 isolates of Staphylococcus epidermidis, and 7 isolates of Staphylococcus saprophyticus. Amplified DNA fragments (amplicons) provided species-specific fingerprints for comparison by agarose gel electrophoresis. A total of 62 distinct RAPD types were categorized from the five genera studied. Typing analysis suggested cross acquisition of E. coli, E. faecalis, and S. aureus in three patient pairs. Genomic polymorphism detection proved efficient and reliable for classifying bacterial subtypes isolated from biofilms adhering to various portions of commonly employed enteral access tubes.

show abstract

A fast method for monitoring the colonization rate of lactobacilli in a meat model system

Cited by 44 publications

References 24 publications

Significant differences between Lactobacillus casei subsp. casei ATCC 393T and a commonly used plasmid-cured derivative revealed by a polyphasic study

Significant differences between Lactobacillus casei subsp. casei ATCC 393T and a commonly used plasmid-cured derivative revealed by a polyphasic study

The Product of arcR , the Sixth Gene of the arc Operon of Lactobacillus sakei , Is Essential for Expression of the Arginine Deiminase Pathway

Typing and Subtyping of 83 Clinical Isolates Purified from Surgically Implanted Silicone Feeding Tubes by Random Amplified Polymorphic DNA Amplification

Contact Info

Product

Resources

About