A functional screening identifies five micrornas controlling glypican-3: role of mir-1271 down-regulation in hepatocellular carcinoma

Abstract

Hepatocellular carcinoma (HCC) is the major primary liver cancer. Glypican-3 (GPC3), one of the most abnormally expressed genes in HCC, participates in liver carcinogenesis. Based on data showing that GPC3 expression is posttranscriptionally altered in HCC cells compared to primary hepatocytes, we investigated the implication of microRNAs (miRNAs) in GPC3 overexpression and HCC. To identify GPC3-regulating miRNAs, we developed a dual-fluorescence FunREG (functional, integrated, and quantitative method to measure posttranscriptional regulations) system that allowed us to screen a library of 876 individual miRNAs. Expression of candidate miRNAs and that of GPC3 messenger RNA (mRNA) was measured in 21 nontumoral liver and 112 HCC samples. We then characterized the phenotypic consequences of modulating expression of one candidate miRNA in HuH7 cells and deciphered the molecular mechanism by which this miRNA controls the posttranscriptional regulation of GPC3. We identified five miRNAs targeting GPC3 3 0 -untranslated region (UTR) and regulating its expression about the 876 tested. Whereas miR-96 and its paralog miR-1271 repressed GPC3 expression, miR-129-1-3p, miR-1291, and miR-1303 had an inducible effect. We report that miR-1271 expression is down-regulated in HCC tumor samples and inversely correlates with GPC3 mRNA expression in a particular subgroup of HCC. We also report that miR-1271 inhibits the growth of HCC cells in a GPC3-dependent manner and induces cell death. Conclusion: Using a functional screen, we found that miR-96, miR-129-1-3p, miR-1271, miR-1291, and miR-1303 differentially control GPC3 expression in HCC cells. In a subgroup of HCC, the up-regulation of GPC3 was associated with a concomitant down-regulation of its repressor miR-1271. Therefore, we propose that GPC3 overexpression and its associated oncogenic effects are linked to the down-regulation of miR-1271 in HCC. (HEPATOLOGY 2013;57:195-204) H epatocellular carcinoma (HCC) is the most common form of primary liver cancer. 1 It usually develops in an affected liver with cirrhosis due to viral infection (hepatitis B virus, HBV; hepatitis C virus, HCV), alcohol abuse, metabolic disorders, or a carcinogenic agent. 1-3 HCC is a very heterogeneous class of tumors characterized by multiple types of genomic damages associated with its various

MicroRNA therapy inhibits hepatoblastoma growth in vivo by targeting β‐catenin and Wnt signaling

“…1A, left panel) 20. This screening allowed the identification of 26 miRNA candidates regulating 5′‐ and 3′‐beta‐catenin UTRs by inducing a 42% decrease or more of GFP‐5′+3′‐UTR‐BCAT transgene expression compared to the control (Fig.…”

“…To assess the relevance of this site, two point mutations (r.614G>C and r.618C>G) were inserted in the beta‐catenin variant V3 3′‐UTR (Fig. 5A) and functional analyses were performed using a reporter system 20, 21. As shown in Fig.…”

“…The lentiviral plasmids pL‐green fluorescent protein (GFP) and pL‐Tomato have been described 20. The lentiviral plasmids pL‐GFP‐5′‐UTR‐beta‐catenin (BCAT), pL‐GFP‐3′‐UTR‐BCAT, and pL‐GFP‐5′+3′‐UTR‐BCAT were constructed as described in the Supporting Materials.…”

“…Cell transfection was carried out as described20, 21, 22 using the following small RNAs: Human miScript miRNA Mimic 96 Set (miRBase V17.0) and AllStars Negative Control siRNA (Qiagen, Hilden, Germany); CTNNB1 small interfering RNA 5′ ACCAGTTGTGGTTAAGCTCTT 3′ (si‐β‐catenin; Eurofin MWG Operon, Ebersberg, Germany).…”

“…To identify new miRNAs, we screened a library of 1,712 miRNA mimics using our dual‐fluorescence‐FunREG screening system 20. We then validated their regulatory effects on endogenous beta‐catenin in the two HBL‐derived cell lines Huh6 and HepG2.…”