A functional variant in ST2 gene is associated with risk of hypertension via interfering MiR‐202‐3p

Abstract

Recent studies have suggested that interleukin 1 receptor‐like 1 (ST2) plays a critical role in pathogenesis of several cardiovascular disease conditions. In this study, we examined association of 13 single nucleotide polymorphisms (SNPs) of ST2 gene with essential hypertension (EH) risk in 1151 patients with EH and 1135 controls. Our study showed that variants rs11685424, rs12999364 and rs3821204 are highly associated with an increase in risk of EH, while rs6543116 is associated with a decrease risk of EH. Notably, in silico analyses suggested the G>C change of rs3821204, which located within the 3′UTR of soluble ST2 mRNA, disrupted a putative binding site for miR202‐3p. Functional analyses suggested that miR‐202‐3p significantly decreased soluble ST2‐G mRNA stability and inhibited its endogenous expression. Furthermore, we found increased plasma‐soluble ST2 (sST2) level was highly associated with CC genotype of rs3821204 in vivo. Taken together, our findings provide the first evidence that genetic variants in ST2 gene are associated with EH risk and variant rs3821204 may influence the development of EH by controlling sST2 expression.

Association between functional polymorphisms in IL‐33/ST2 pathway and risk of osteosarcoma

“…Previous study showed that the rs3821204 disrupted a miR‐202‐3p seeding site, resulted in an allelic difference of sST2 mRNA stability and expression, and finally modified the susceptibility of hypertension . In this study, we cotransfected rs3821204 G or C plasmid with miR‐202‐3p mimics (50 μmol/L) or negative control into HEK293 cells and confirmed the alteration of miR‐202‐3p binding site and a significantly decreased luciferase activity of rs3821204‐G but not rs3821204‐C (Figure A,B).…”

“…The insert sequences (rs7025417T and rs7025417C) were verified by Sanger sequencing. Plasmid containing the ST2 rs3821204 G or rs3821204 C was constructed as described previously . Briefly, The 3′‐UTR fragment of ST2 was amplified using the following primers: 5′‐GTCTCTAGAATCCCCCACTCCCTCC‐3′ (forward) and 5′‐CAGTCTAGAATCTGTGTTCCTGCCC‐3′ (reverse).…”

“…Because IL‐33 exerts functions via ST2, another SNP rs3821204 was selected, which was located within the 3′ untranslated region (UTR) of ST2 mRNA. The rs3821204 can disrupt the binding site of miR‐202‐3p and finally affect plasma‐soluble ST2 levels . To date, no study has reported on the association of the 2 functional SNPs with OS risk.…”

RETRACTED ARTICLE: Overexpression of microRNA-202-3p protects against myocardial ischemia-reperfusion injury through activation of TGF-β1/Smads signaling pathway by targeting TRPM6

“…Ct refers to the number of amplification cycles when the real-time fluorescence intensity reached the set threshold whereby the amplification procedure was in the logarithmic growth phase. The measurement was repeated 3 times [24][25][26].…”

MiR-202-3p Inhibits Foam Cell Formation and is Associated with Coronary Heart Disease Risk in a Chinese Population

“…A previous study of our lab demonstrated the critical role of miR-202-3p in essential hypertension. 6) Numerous studies also indicated that miR-202-3p functions as a tumor suppressor in the carcinogenesis of multiple solid tumors including bladder, breast, colorectal, gastric, and pancreatic cancers. [7][8][9][10] A gene-annotation enrichment analysis for potential targets of miR-202-3p suggested that it might be implicated in cardiovascular and metabolic diseases.…”