A gel retardation assay system for studying protein binding to simple repetitive DNA sequences

Abstract

Simple repetitive DNA sequences have been regarded as mere "junk" present in all eukaryotic genomes. In fact, mixed simple repeat (gt)n(ga)m sequences are present in major histocompatibility complex MHC-DRB genes for long evolutionary times, including such distant animals as artiodactyla and man. We describe herein an unsophisticated method which reveals that at least certain simple repetitive (gt)n(ga)m sequences bind nuclear proteins and show characteristics of a specific DNA-protein interaction via gel retardation.

PCR amplification products are of limited use for the study of DNA/protein interaction

“…The 3' end-labeled (gt)16(ga)8 containing DNAbinds at least one nuclear protein [6].Therefore we investigated if protein binding to the PCRproducts is influenced using a gel retardation assay system. The 3' end-labeled DNA showed 4 retarded bands (Fig.…”

“…As template DNA 10 ng of an approximately 500 bp EcoRl/HindIIl insert of pEMBL 19, containing exon 2 and intron 2 of the human MHC-DRBI *0401 allele [5] was used. Amplification (20 cycles) was achieved by annealing the oligonucleotides GAATCTGAGTGTGTGTGTGT and GATAGAGAG-GATTCTAAATGC as specific primers (10 pmoles of each) at 51°C to enrich a 115 bp long (gt)16(ga)8 containing ds DNA, which is known to bind at least one nuclear protein [6]. Approximately 100 000 cpm of each sample were applied to native PAGE.…”

“…After electrophoresis the gel was fixed (10% methanol, 12% acetic acid), dried and exposed to X-ray film (XAR-5, Kodak). Preparation of nuclear extracts and gel retardation assays were performed as described [6].…”

Genomic simple repetitive DNAs are targets for differential binding of nuclear proteins

“…Clearly, the binding characteristics for different motifs are different. Different targets bind different nuclear proteins [25][26][27][28][29][30] (Table 1). The binding affinities are not only based on the motifs, but they also depend on a minimal length of the simple repeat block (see Fig.…”

“…-+++ aFor all methodological details and further explanations see [25][26][27][28][29]. bEach of the simple repeat targets was an efficient competitor for protein binding whenever itself was the labelled target.…”