A Glycosyltransferase Involved in Biosynthesis of Triglycosylated Glycopeptidolipids inMycobacterium smegmatis: Impact on Surface Properties

Abstract

The cell envelope of mycobacteria is a complex structure that plays an important role in the interactions of the cell with its environment and in the protection against the antimicrobial activity of the immune system. Glycopeptidolipids (GPLs) are species-or type species-specific glycolipids that are present at the surface of a number of mycobacteria and that are characterized by a high variability in glycosylation patterns. These GPLs possess various biological activities that depend mostly on the sugars capping the core molecule. In Mycobacterium smegmatis, the GPL core can be substituted by either two or three deoxyhexoses. In this study, we show that Gtf3 is a glycosyltransferase responsible for the synthesis of the triglycosylated GPLs. Biochemical analysis of these molecules, with a combination of mass spectrometry and chemical degradation methods, has shown that they contain three deoxyhexose moieties. The presence of the triglycosylated GPLs is associated with cell surface modifications that lead to a decrease in sliding motility as well as a modification in cellular aggregation and colony appearance on Congo red. Phylogenetic analysis indicated that Gtf3 is a member of a yet-uncharacterized glycosyltransferase family conserved among the mycobacteria.The mycobacterial envelope confers to mycobacteria a high impermeability to chemical disinfectants and to some antibiotics and contributes also, in the case of the pathogenic species, to the ability to survive in macrophages. This envelope is composed of a plasma membrane surrounded by a complex cell wall, which in turn is covered by a superficial layer, also called a capsule in the case of pathogenic species. The cell wall consists of a monolayer of mycoloyl residues covalently linked to the peptidoglycan-arabinogalactan complex and includes other lipids which are probably arranged to form a bilayer with the mycoloyl residues. The outermost structure, composed of proteins, carbohydrates, and (to a lesser extent) lipids, represents a privileged interface between bacilli and their environment. Both the outer lipid layer of the cell wall and the outermost capsule contain species-specific glycolipids or phospholipids (8,12,16). Glycopeptidolipids (GPLs) are the predominant glycolipids in members of the Mycobacterium avium complex, a group of subspecies involved in zoonotic infection and in the infection of immunocompromised patients. GPLs are also present at the surface of M. smegmatis, a saprophytic species (17). Purified GPLs are able to disturb macrophage membrane ultrastructure (42) and to insert into phospholipid monolayers (47) or to inhibit nonopsonic phagocytosis of mycobacteria by human macrophages (48), thus suggesting a potential role in the virulence of mycobacteria. It has been shown that GPLs can decrease the phosphorylation efficiency of isolated mitochondria without modifying the active respiration (30). GPLs also play a role in sliding motility and in biofilm formation (33), probably through the interaction between the support and the bacterial...

Glycopeptidolipids: Immuno‐modulators in greasy mycobacterial cell envelope

“…Hereafter, they diverge to form hyperglycosylated GPLs in M. smegmatis with an extra sugar attached to the existing rhamnose linked to alaninol. A third glycosyltransferase, Gtf3 was found to be responsible for this hyper-glycosylation (49,50). The same gtf3 gene was up-regulated during carbon starvation, which resulted in the formation of smooth colony morphology.…”

Novel Functions of (p)ppGpp and Cyclic di-GMP in Mycobacterial Physiology Revealed by Phenotype Microarray Analysis of Wild-Type and Isogenic Strains of Mycobacterium smegmatis

“…Aggregation assay. The protocol for the aggregation assay was adapted from that of Deshayes et al (36). Bacteria were grown until stationary phase in MB7H9 medium supplemented with 2% glucose and 0.05% Tween 80.…”

SigF Controls Carotenoid Pigment Production and Affects Transformation Efficiency and Hydrogen Peroxide Sensitivity in Mycobacterium smegmatis

“…The former primer was designed to contain an ribosome binding site (underlined). From previous experience, we know that cloning a gene at this site in pNIP40b leads to a transcriptional fusion with an upstream promoter and leads to expression of the transgene (7,8,28). The recombinant plasmid, pNIP40b/ sigF, was introduced into the sigF mutant by electroporation as previously described (20).…”

“…In M. smegmatis, sigF seems to be part of the same transcription unit with rsbW, the gene encoding its putative anti-sigma factor, as in M. tuberculosis (3), since the sigF GTG start codon overlaps with the TGA stop codon of rsbW. Therefore, a fragment of 753 bp, containing the putative ribosome binding site upstream of the rsbW stop codon and the entire coding sequence of sigF, was amplified by PCR and cloned into the integrative expression vector pNIP40b between the XbaI and SpeI (indicated by lowercase letters) sites by using the primers RP283 (tctagaAAATTCCA GGAGGTCAGGTGACGTCGGAATACGCAGACGTTC) and RP271 (actagtGGCATTCCGAAGCGAGTTCC) (8,28). The former primer was designed to contain an ribosome binding site (underlined).…”