A Halotolerant Bacterium Bacillus licheniformis HSW-16 Augments Induced Systemic Tolerance to Salt Stress in Wheat Plant (Triticum aestivum)

Abstract

Certain plant growth promoting bacteria can protect associated plants from harmful effects of salinity. We report the isolation and characterization of 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase bacterium Bacillus licheniformis HSW-16 capable of ameliorating salt (NaCl) stress in wheat plants. The bacterium was isolated from the water of Sambhar salt lake, Rajasthan, India. The presence of ACC deaminase activity was confirmed by enzyme assay and analysis of AcdS gene, a structural gene for ACC deaminase. Inoculation of B. licheniformis HSW-16 protected wheat plants from growth inhibition caused by NaCl and increased plant growth (6-38%) in terms of root length, shoot length, fresh weight, and dry weight. Ionic analysis of plant samples showed that the bacterial inoculation decreased the accumulation of Na+ content (51%), and increased K+ (68%), and Ca2+ content (32%) in plants at different concentration of NaCl. It suggested that bacterial inoculation protected plants from the effect of NaCl by decreasing the level of Na+ in plants. Production of exopolysaccharide by the B. licheniformis HSW-16 can also protect from Na+ by binding this ion. Moreover, application of test isolate resulted in an increase in certain osmolytes such as total soluble sugar, total protein content, and a decrease in malondialdehyde content, illustrating their role in the protection of plants. The ability of B. licheniformis HSW-16 to colonize plant root surface was examined by staining the bacterium with acridine orange followed by fluorescence microscopy and polymerase chain reaction-based DNA finger printing analysis. These results suggested that B. licheniformis HSW-16 could be used as a bioinoculant to improve the productivity of plants growing under salt stress.

Microbiological Insights into the Stress-Alleviating Property of an Endophytic Bacillus altitudinis WR10 in Wheat under Low-Phosphorus and High-Salinity Stresses

“…Growth test showed B. altitudinis WR10 is extraordinarily resistant to NaCl, e.g., 12% (~2 M, Figure 2a), suggesting the strain is a halotolerant bacterium. Halotolerant bacteria grown in the range of 2-11% NaCl had been widely explored for promoting growth and augmenting tolerance to salinity in wheat [36][37][38]. They counter salinity stress by producing osmolytes that help plant keep normal osmosis and electrical conductivity [39].…”

“…To further correlate the growth-promoting properties, B. altitudinis WR10 was characterized by growth test under different conditions. Growth was monitored at different temperatures (10,20,30,37,40,50,55, or 60 • C) and NaCl concentrations (0, 0.5, 1.0, 2.0, 4.0, 6.0, 8.0, 10.0, 12.0, or 14.0%, w/v) in tubes containing 5 mL liquid LB broth. Tolerance to pH was evaluated between 2.0 and 11.0 with intervals of one unit by adding concentrated HCl or 2 M NaOH solutions into 5 mL LB broth.…”

Bacillus subtilis HG-15, a Halotolerant Rhizoplane Bacterium, Promotes Growth and Salinity Tolerance in Wheat (Triticum aestivum)

“…After the mixture was left standing for 10 min, the control was treated with the same amount of sterile LB. Absorbance was measured at 420 nm in a cuvette with a light path of 20 mm, and the amount of ammonia produced was determined according to an ammonium standard curve [64].…”

“…Jha [64], rep-PCR gene fingerprints of HG-15 strain and strains recovered from wheat rhizosphere soil, roots, stems, and leaves indicates colonization. We used a rep-PCR reaction mixture containing 25 μL 10 × Taq PCR master mix, 1 μL template DNA, 2 μL of BOX-AIR primer (CTACGGCAAGGCGACGCTGACG) (Sangon, China), and 22 μL of ddH 2 O. PCR amplification was performed under the following conditions: initial denaturation at 95°C for 7 min; 35 cycles of 94°C for 1 min, 53°C for 1 min, and 65°C for 8 min; and a final extension at 65°C for 16 min.…”

Beneficial microbiomes: Biodiversity and potential biotechnological applications for sustainable agriculture and human health

“…Cold stress Growth and alleviation [82] Bacillus aryabhattai BCZ17 Drought and heat stress Growth, yield, stress [81] Bacillus endophyticus BNW9 Alkalinity stress Growth and alleviate alkalinity [81] Bacillus licheniformis HSW-16 Salinity stress Growth and productivity [83] Bacillus nanhaiensis IARI-THD-20 Alkalinity stress Growth and alleviation [15] Bacillus safensis W10 Drought and heat stress Plant growth and yield [84] Burkholderia phytofirmans PsJN Drought and heat stress Growth and grain yield [85] Cellulomonas turbata AS1 Cold stress Growth and yield [86] Flavobacterium psychrophilum HHS2-37 Cold stress Growth and yield [28] Klebsiella sp. SBP-8 Salinity stress Plant growth and yield [87] Lysinibacillus fusiformis IARI-THD-4 Acidic stress Growth and yield [15] Micrococcus roseus SW1 Acidic stress Growth and yield [88] Paenibacillus polymyxa BNH18 Cold stress Growth, alleviate cold [81] Paenibacillus xylanexedens BNW24 Alkalinity stress Growth and alleviate alkalinity [81] Pantoea intestinalis DSM 28113 T Drought and heat stress Alleviate drought stress [89] Piriformospora indica (Pi) Drought and heat stress Drought resistance, growth [90] Planococcus salinarum BSH13 Acidic stress Growth and alleviate acidity [81] Pseudomonas fluorescens 153 Salinity stress Salinity stress, growth [91] Pseudomonas lurida M 2 RH 3 Cold stress Growth and nutrient uptake [92] Pseudomonas poae IARI-NIAW2-1 Drought and heat stress Growth, yield [13] Pseudomonas putida AKMP7 Drought and heat stress Growth, alleviate heat stress [93] Pseudomonas putida 108 Salinity stress Salinity stress, growth [91] Pseudomonas rhizosphaerae IARI-DV-26 Alkalinity stress Growth and alleviation [81] Pseudomonas sp.…”