A high-coverage shRNA screen identifies TMEM129 as an E3 ligase involved in ER-associated protein degradation

Abstract

Misfolded ER proteins are retrotranslocated into the cytosol for degradation via the ubiquitin–proteasome system. The human cytomegalovirus protein US11 exploits this ER-associated protein degradation (ERAD) pathway to downregulate HLA class I molecules in virus-infected cells, thereby evading elimination by cytotoxic T-lymphocytes. US11-mediated degradation of HLA class I has been instrumental in the identification of key components of mammalian ERAD, including Derlin-1, p97, VIMP and SEL1L. Despite this, the process governing retrotranslocation of the substrate is still poorly understood. Here using a high-coverage genome-wide shRNA library, we identify the uncharacterized protein TMEM129 and the ubiquitin-conjugating E2 enzyme UBE2J2 to be essential for US11-mediated HLA class I downregulation. TMEM129 is an unconventional C4C4-type RING finger E3 ubiquitin ligase that resides within a complex containing various other ERAD components, including Derlin-1, Derlin-2, VIMP and p97, indicating that TMEM129 is an integral part of the ER-resident dislocation complex mediating US11-induced HLA class I degradation.

RhoA knockout fibroblasts lose tumor-inhibitory capacity in vitro and promote tumor growth in vivo

“…We prepared lentiviral CRISPR/Cas9 vectors that coexpressed Streptococcus pyogenes Cas9, PuroR, and a human U6 promoter driving expression of anti-RhoA guideRNAs (40). The genespecific regions of the guideRNA sequences were designed by the CRISPR design tool from the Zhang laboratory (crispr.mit.edu/), and their sequences were: RhoA_1, GAACTATGTGGCAGATATCG; RhoA_2, GACAGCCCTGATA-GTTT; and RhoA_3, GCTGCCATCCGGAAGAAAC.…”

Restraining FOXO3-dependent transcriptional BMF activation underpins tumour growth and metastasis of E-cadherin-negative breast cancer

“…Forty-eight hours after transfection, cells were harvested and seeded for anoikis assays. 50,51 Immunoblotting and antibodies. Proteins were detected using SDS-PAGE and subsequent western blotting analysis with primary antibodies recognising BAD (CST-9292, Cell Signaling Technology, Leiden, The Netherlands), BIM (CST-2819) BMF (human: CST-5889, mouse: ENZO-17A9), BID (SC-11423 Santa Cruz, Heidelberg, Germany), AKT/PKB (CST), FOXO1 (CST-29H4), FOXO3 (H144 Santa Cruz), NOXA (SP7122p Acris, Herford, Germany), PUMA (CST-4976) and BCL2 (CST-2876) used at 1 : 2000.…”

“…Lentiviral cDNA expression vectors expressing iBMF, iFOXO3 and iFOXO3.A3 were generated using Gateway cloning in the pINDUCER20 Dox-inducible expression system. 50 Guide RNAs for Cdh1.1 and Cdh1.2 CRISPR were cloned into the lentiviral pSicoR CRISPR/Cas9 vector 51 using BsmBI restriction sites (Supplementary Table S1). After lentiviral transduction, cells were selected for incorporation using puromycin and subsequently FACS-sorted based on E-cadherin expression (DECMA-1, 1 : 2000; Abcam no.…”

Inactive rhomboid proteins: New mechanisms with implications in health and disease

“…In this canonical dislocation route, multiple quality control factors such as Sel1L, which mediates interaction with the luminal lectin OS9 and acts as substrate receptor for soluble ERAD substrates [76], or BAP31, a protein sorting factor for TM cargo [77], collectively deliver ERAD substrates to Derlin1. More recently, an alternative dislocation route centered on the E3 ligase TMEM129 has been shown to mediate human cytomegalovirus-induced MHC degradation of MHC class I [78,79].…”