A Key Role for Heat Shock Protein 70 in the Localization and Insertion of Tombusvirus Replication Proteins to Intracellular Membranes

Wang, Chia Hui; Stork, Jozsef; Nagy, Peter D.

doi:10.1128/jvi.02313-08

Cited by 128 publications

(137 citation statements)

References 71 publications

Supporting

Mentioning

131

Contrasting

Order By: Relevance

“…In Chenopodium quinoa plants heat shocked to induce HSP70 expression and then challenged with CNV, viral genomic RNA accumulation increased (Alam and Rochon, 2015). Silencing the expression of cytosolic Nicotiana HSP70 family members in N. benthamiana using the TRV-or PVXbased VIGS vectors resulted in dwarfed and crinkled leaves or white spots near major veins in developing leaves (Chen et al, 2008;Wang et al, 2009). We previously observed a dwarfing phenotype after we silenced HSP70 in barley with our original BMV vector (Ramanna et al, 2013).…”

Section: Discussionmentioning

confidence: 99%

An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS

et al. 2017

View full text Add to dashboard Cite

Section: Discussionmentioning

confidence: 99%

An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS

et al. 2017

View full text Add to dashboard Cite

“…The VIGS assay to silence SMO1 and SMO2 in N. benthamiana was performed as described previously (53). Eleven days after the agroinfiltration of pTRV2-SMO1 and pTRV2-SMO2, the accumulation levels for N. benthamiana SMO1 and SMO2 mRNAs in N. benthamiana were determined by semiquantitative RT-PCR with primers 3273 (CCTAATCTTCTCTTGTGTCCCTC) and 2902 and the primer pair of 3274 (CAATTGACTTGTCTTGGTGGGTTT) and 3275 (CAAGGACTCTAAGTGAGACCC), respectively (10).…”

Section: Methodsmentioning

confidence: 99%

“…The obtained RT-PCR products were sequenced to confirm their identities. The VIGSsilenced leaves were sap inoculated with TBSV or TMV as described previously (53). Total RNA extracts from the infected leaves were prepared at 3 dpi (days postinoculation) and from systemically infected leaves at 5 dpi to analyze TBSV and TRV accumulation.…”

Section: Methodsmentioning

confidence: 99%

Inhibition of Sterol Biosynthesis Reduces Tombusvirus Replication in Yeast and Plants

Sharma

Sasvari

Nagy

2010

J Virol

Self Cite

View full text Add to dashboard Cite

The replication of plus-strand RNA viruses depends on subcellular membranes. Recent genome-wide screens have revealed that the sterol biosynthesis genes ERG25 and ERG4 affected the replication of Tomato bushy stunt virus (TBSV) in a yeast model host. To further our understanding of the role of sterols in TBSV replication, we demonstrate that the downregulation of ERG25 or the inhibition of the activity of Erg25p with an inhibitor (6-amino-2-n-pentylthiobenzothiazole; APB) leads to a 3-to 5-fold reduction in TBSV replication in yeast. In addition, the sterol biosynthesis inhibitor lovastatin reduced TBSV replication by 4-fold, confirming the importance of sterols in viral replication. We also show reduced stability for the p92 pol viral replication protein as well as a decrease in the in vitro activity of the tombusvirus replicase when isolated from APB-treated yeast. Moreover, APB treatment inhibits TBSV RNA accumulation in plant protoplasts and in Nicotiana benthamiana leaves. The inhibitory effect of APB on TBSV replication can be complemented by exogenous stigmasterol, the main plant sterol, suggesting that sterols are required for TBSV replication. The silencing of SMO1 and SMO2 genes, which are orthologs of ERG25, in N. benthamiana reduced TBSV RNA accumulation but had a lesser inhibitory effect on the unrelated Tobacco mosaic virus, suggesting that various viruses show different levels of dependence on sterol biosynthesis for their replication.Plus-stranded RNA [(ϩ)RNA] viruses usurp various intracellular/organellar membranes for their replication. These cellular membranes are thought to facilitate the building of viral factories, promote a high concentration of membrane-bound viral proteins, and provide protection against cellular nucleases and proteases (1,12,35,44). The membrane lipids and proteins may serve as scaffolds for targeting the viral replication proteins or for the assembly of the viral replicase complex. The subcellular membrane also may provide critical lipid or protein cofactors to activate/modulate the function of the viral replicase. Indeed, the formation of spherules, consisting of lipid membranes bended inward and viral replication proteins as well as recruited host proteins, has been demonstrated for several (ϩ)RNA viruses (20,30,48). These virus-induced spherules serve as sites of viral replication. Importantly, (ϩ)RNA viruses also induce membrane proliferation that requires new lipid biosynthesis. Therefore, it is not surprising that several genome-wide screens for the identification of host factors affecting (ϩ)RNA virus replication unraveled lipid biosynthesis/metabolism genes (8,23,38,50). However, in spite of these intensive efforts, understanding the roles of various lipids and lipid biosynthesis enzymes and pathways in (ϩ)RNA virus replication is limited.Tomato bushy stunt virus (TBSV) is among the most advanced model systems regarding the identification of host factors affecting (ϩ)RNA virus replication (32). Among the five proteins encoded by the TBSV genome, only the p33 re...

show abstract

“…Several reports, particularly on positive-strand RNA viruses of plants, examined the key role of cellular chaperones and folding enzymes. During plant virus infection, several Hsp proteins are involved in the formation of membrane-bound RCs for certain members of the Tombusvirus, Tobamovirus, Potyvirus, and Potexvirus genera (50)(51)(52)(53). There are several cochaperones, including Hsp40, that associate with the bromovirus RC (54)(55)(56).…”

Section: Discussionmentioning

confidence: 99%

Chaperone-Assisted Protein Folding Is Critical for Yellow Fever Virus NS3/4A Cleavage and Replication

Bozzacco

Andréo

et al. 2016

J Virol

View full text Add to dashboard Cite

DNAJC14, a heat shock protein 40 (Hsp40) cochaperone, assists with Hsp70-mediated protein folding. Overexpressed DNAJC14 is targeted to sites of yellow fever virus (YFV) replication complex (RC) formation, where it interacts with viral nonstructural (NS) proteins and inhibits viral RNA replication. How RCs are assembled and the roles of chaperones in this coordinated process are largely unknown. We hypothesized that chaperones are diverted from their normal cellular protein quality control function to play similar roles during viral infection. Here, we show that DNAJC14 overexpression affects YFV polyprotein processing and alters RC assembly. We monitored YFV NS2A-5 polyprotein processing by the viral NS2B-3 protease in DNAJC14-overexpressing cells. Notably, DNAJC14 mutants that did not inhibit YFV replication had minimal effects on polyprotein processing, while overexpressed wild-type DNAJC14 affected the NS3/4A and NS4A/2K cleavage sites, resulting in altered NS3-to-NS3-4A ratios. This suggests that DNAJC14's folding activity normally modulates NS3/4A/2K cleavage events to liberate appropriate levels of NS3 and NS4A and promote RC formation. We introduced amino acid substitutions at the NS3/4A site to alter the levels of the NS3 and NS4A products and examined their effects on YFV replication. Residues with reduced cleavage efficiency did not support viral RNA replication, and only revertant viruses with a restored wild-type arginine or lysine residue at the NS3/4A site were obtained. We conclude that DNAJC14 inhibition of RC formation upon DNAJC14 overexpression is likely due to chaperone dysregulation and that YFV probably utilizes DNAJC14's cochaperone function to modulate processing at the NS3/4A site as a mechanism ensuring virus replication. IMPORTANCEFlaviviruses are single-stranded RNA viruses that cause a wide range of illnesses. Upon host cell entry, the viral genome is translated on endoplasmic reticulum (ER) membranes to produce a single polyprotein, which is cleaved by host and viral proteases to generate viral proteins required for genome replication and virion production. Several studies suggest a role for molecular chaperones during these processes. While the details of chaperone roles have been elusive, in this report we show that overexpression of the ER-resident cochaperone DNAJC14 affects YFV polyprotein processing at the NS3/4A site. This work reveals that DNAJC14 modulation of NS3/4A site processing is an important mechanism to ensure virus replication. Our work highlights the importance of finely regulating flavivirus polyprotein processing. In addition, it suggests future studies to address similarities and/or differences among flaviviruses and to interrogate the precise mechanisms employed for polyprotein processing, a critical step that can ultimately be targeted for novel drug development.

show abstract

A Key Role for Heat Shock Protein 70 in the Localization and Insertion of Tombusvirus Replication Proteins to Intracellular Membranes

Cited by 128 publications

References 71 publications

An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS

An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS

Inhibition of Sterol Biosynthesis Reduces Tombusvirus Replication in Yeast and Plants

Chaperone-Assisted Protein Folding Is Critical for Yellow Fever Virus NS3/4A Cleavage and Replication

Contact Info

Product

Resources

About