A metal‐repressed promoter from gram‐positive Bacillus subtilis is highly active and metal‐induced in gram‐negative Cupriavidus metallidurans

Abstract

A synthetic version of the metal-regulated gene A (mrgA) promoter from Bacillus subtilis, which in this Gram-positive bacterium is negatively regulated by manganese, iron, cobalt, or copper turned out to promote high level of basal gene expression that is further enhanced by Co(II), Cd(II), Mn(II), Zn(II), Cu(II), or Ni(II), when cloned in the Gram-negative bacterium Cupriavidus metallidurans. Promoter activity was monitored by expression of the reporter gene coding for the enhanced green fluorescent protein (EGFP), and cellular intensity fluorescence was quantified by flow cytometry. Expression levels in C. metallidurans driven by the heterologous promoter, here called pan, ranged from 20- to 53-fold the expression level driven by the Escherichia coli lac promoter (which is constitutively expressed in C. metallidurans), whether in the absence or presence of metal ions, respectively. The pan promoter did also function in E. coli in a constitutive pattern, regardless of the presence of Mn(II) or Fe(II). In conclusion, the pan promoter proved to be a powerful tool to express heterologous proteins in Gram-negative bacteria, especially in C. metallidurans grown upon high levels of toxic metals, with potential applications in bioremediation.

Synthetic Phytochelatin Surface Display in Cupriavidus metallidurans CH34 for Enhanced Metals Bioremediation

“…25−27 The pBB-panEGFP plasmid carries the pan promoter, previously described in our laboratory as a strong promoter for expression in C. metallidurans. 19 The SS-EC20sp-E-tag-IgAβ fragment was cloned under pan promoter control, replacing the egf p gene in pBB-panEGFP, and the final plasmid, named pCM2 (Figure 1D), was used in the genetic transformation of C. metallidurans CH34 cells.…”

“…The amplified fragment was cloned in pCR2.1-TOPO (Invitrogen, Carslbad, CA). The SS-EC20sp-E-tag-IgAβ fragment was isolated by NdeI and KpnI digestion and cloned in the pBB-panEGFP plasmid, 19 previously digested with the same enzymes and removal of the egf p gene. The final plasmid was named pCM2 and the construction was sequenced using the 5′CCGCGGTTCGGTATCGAAAGC3′ primer (Figure 1C and 1D).…”

Heterologous expression of proteorhodopsin enhances H2 production in Escherichia coli when endogenous Hyd-4 is overexpressed

“…This promoter is a synthetic version of the mrgA promoter from Bacillus subtilis, which displays constitutive activity in Gram-negative bacteria (Ribeiro-dos-Santos et al, 2010). Quantification of EGFP expression driven by pan or lac promoters in E. coli reveals that both promoters display a low constitutive expression in E. coli and, in the presence of IPTG, only the lac promoter shows an enhancement in EGFP expression (Ribeiro-dos-Santos et al, 2010). For physiological studies, proteorhodopsin was cloned with its native N-terminal signal sequence and a V5 epitope in the COOH-terminus.…”

Recombinant tagging system using ribosomal frameshifting to monitor protein expression

“…In particular, green fluorescent protein (GFP) from jellyfish is a versatile fluorescent protein marker, because it does not require additional cofactors or substrates (Chalfie et al, 1994). Since the GFP fluorescence signal is correlated to protein concentration, GFP can be used as a quantitative tool for real time identification of gene expression Kottmeier et al, 2011;Kuhn et al, 2010;Liu et al, 2008;Ribeiro-dos-Santos et al, 2010;Zhang and Yang, 2006). Since the GFP fluorescence signal is correlated to protein concentration, GFP can be used as a quantitative tool for real time identification of gene expression Kottmeier et al, 2011;Kuhn et al, 2010;Liu et al, 2008;Ribeiro-dos-Santos et al, 2010;Zhang and Yang, 2006).…”

“…A fusion protein of target and GFP proteins can be expressed in cells or organisms, and GFP fusion tags allow direct visualization of a target protein during dynamic cellular events (Bastiaens and Pepperkok, 2000;Lippincott-Schwartz et al, 2001). Since the GFP fluorescence signal is correlated to protein concentration, GFP can be used as a quantitative tool for real time identification of gene expression Kottmeier et al, 2011;Kuhn et al, 2010;Liu et al, 2008;Ribeiro-dos-Santos et al, 2010;Zhang and Yang, 2006). In many studies, the target protein was expressed only as fusions with GFP (March et al, 2003); multiple genes were fused in tandem to improve the yield of the target protein (Wu et al, 2001).…”