A Model System for Feralizing Laboratory Mice in Large Farmyard-Like Pens

Abstract

Laboratory mice are typically housed under extremely clean laboratory conditions, far removed from the natural lifestyle of a free-living mouse. There is a risk that this isolation from real-life conditions may lead to poor translatability and misinterpretation of results. We and others have shown that feral mice as well as laboratory mice exposed to naturalistic environments harbor a more diverse gut microbiota and display an activated immunological phenotype compared to hygienic laboratory mice. We here describe a naturalistic indoors housing system for mice, representing a farmyard-type habitat typical for house mice. Large open pens were installed with soil and domestic animal feces, creating a highly diverse microbial environment and providing space and complexity allowing for natural behavior. Laboratory C57BL/6 mice were co-housed in this system together with wild-caught feral mice, included as a source of murine microbionts. We found that mice feralized in this manner displayed a gut microbiota structure similar to their feral cohabitants, such as higher relative content of Firmicutes and enrichment of Proteobacteria. Furthermore, the immunophenotype of feralized mice approached that of feral mice, with elevated levels of memory T-cells and late-stage NK cells compared to laboratory-housed control mice, indicating antigenic experience and immune training. The dietary elements presented in the mouse pens could only moderately explain changes in microbial colonization, and none of the immunological changes. In conclusion, this system enables various types of studies using genetically controlled mice on the background of adaptation to a high diversity microbial environment and a lifestyle natural for the species.

Mast Cells Are Identified in the Lung Parenchyma of Wild Mice, Which Can Be Recapitulated in Naturalized Laboratory Mice

“…We therefore explored whether it was possible to repopulate lung mast cells in the laboratory mice by exposing them to a natural environment mimicking the natural habitat of wild mice. Laboratory mice were bred in a closed area with bedding material obtained from the natural rodent living environment ( Figure 4A ) ( 21 ). We collected offspring mice who spent their entire life in this semi-natural, dirty environment when they were eight weeks old for analysis.…”

“…Free-living mice were captured in Hemtabad, West Bengal, India. Furthermore, wild-caught and control laboratory mice from Norway were obtained from a previously reported material ( 6 , 21 ). The Mus musculus identity of the wild mice were confirmed as previously described ( 22 ) or by PCR genotyping based on the Mus musculus -specific GAPDH gene sequences using two sets of primers (forward 5’-TGGCCGGATACCTAGTTCCA-3’; reverse 5’-AGGTGAATCAGGGAAGCAGC-3’, and forward 5’- AACAACTGGCTTTCCACCCA -3’; reverse 5’-ACTGCCTGGTAAAGGTCACG-3’).…”

“…Both female and male C57BL/6 mice were housed in mouse pens designed with a naturalistic farm-like environment as previously reported ( 21 ), however, without the direct presence of wild-caught mice. Briefly, a purposefully built, closed environment was prepared with bedding material regularly brought in from domestic animal farmhouses, as well as sawdust, soil, compost, twigs and hay.…”

Use of Precision-Cut Tissue Slices as a Translational Model to Study Host-Pathogen Interaction

“…Small rodent models have been invaluable in our quest to better understand host-pathogen interaction, but it becomes increasing clear that the immune system of farmed animals and humans on one side and small rodents on the other side have to many differences (20)(21)(22)(23). Thus, there is a need for alternatives to better translate between laboratory models and the clinic, without increasing the numbers of animals used.…”

Controlled Complexity: Optimized Systems to Study the Role of the Gut Microbiome in Host Physiology

“…However, while we and others ( Hamilton et al, 2020 ; Graham, 2021 ; Kuypers et al, 2021 ) posit that wild microbiome-elicited phenotypes create a murine system with a more human-like phenotype, different approaches to wilding the microbiome including the specific donor material used, or the creation of environments that more accurately mimic the natural environment of the mouse ( Arnesen et al, 2020 ; Lin et al, 2020 ; Yeung et al, 2020 ) vs. co-housing under controlled laboratory conditions ( Beura et al, 2016 ; Rosshart et al, 2017 ), may lead to disparate phenotypic outcomes in recipients. The use of wild microbiomes thus may not fully humanize the murine response or be fully representative of human phenomena.…”