A MODIFIED DNA EXTRACTION MINIPREPARATION PROTOCOL FOR FUSARIUM ISOLATES

Abstract

We have modified a quick, inexpensive and less prone to contamination protocol by culturing the cryopreserved or fresh mycelium directly in 96deepwell plate. The method facilitates concom*tant assessment of ssDNA fungal diversity by asymmetric PCR (A-PCR) from a single extraction. The DNA yields from Fusarium spp. isolates was reasonably high, and a clear DNA band was frequently seen when I0 pL. of the PCR product was run in agarose gel. The procedure can be completed in less than 4 h and 96 samples can be processed at the same time.

Identification and characterization of Fusarium mangiferae as pathogen of mango malformation in India

“…The species are F. mangiferae from Egypt [3] , Israel [34] , South Africa [10] , Pakistan [35] , F. proliferatum from Malaysia [36] , and F. subglutinans reported from South Africa, India and USA [37] . PCR products of 570 bp, 398 bp and 235 bp amplified in F. mangiferae using Fusarium species-specific [25] ITS primers and β-tubulin gene-specific primers, respectively. By contrast, the nested PCR approach presented here produced consistent and reproducible results using β-tubulin gene-specific designed primers.…”

“…Fresh mycelium from all 11 representative isolates collected for genomic DNA extraction according to the protocol of Abd-Elsalam et al [25] . 100 mg mycelium homogenized using 300 µl of extraction buffer containing 200 mM Tris-HCl (pH 8.5), 250 mM NaCl, 25 mM EDTA and 0.5 % of sodium dodecyl sulphate and centrifuged at maximum speed for 5 min.…”

“…ITS-PCR for isolates performed by adopting the protocol described by Abd-Elsalam et al [25] . PCR reactions for amplification of ITS regions were performed using the ITS1 5'TCCGTAGGTGAACCTGCGG 3' and ITS4 3' TCCTCCGCTTATTGATATGC 5' primer pair [19] in reaction volumes of 50 µl containing 25 ng of genomic DNA, 1X PCR buffer (Invitrogen), 0.20 mM of each dNTP (Invitrogen), 1.5 mM MgCl2, 1 µM primers and 1U Taq polymerase (Invitrogen).…”

Microsatellite marker-based detection ofFusariumwilt pathogens ofPsidium guajavaL.

“…The mycelia were filtered from liquid medium through four-layered cheesecloth. Total DNA was extracted according to the protocol of Abd-Elsalam et al (2003).…”

Morphological, pathological and molecular variability of Colletotrichum capsici causing anthracnose of chilli in the North-east of Thailand

“…The isolates were cultured in potato dextrose broth (PDB) at ambient temperature for 5 days. Mycelia harvested from the PDB were homogenized in a microcentrifuge tube and genomic DNA was extracted using the procedure described by Abd-Elsalam et al (2003). The final DNA pellet was re-suspended in 4 0µl of TE buffer (10 mM Tris-HCl, 1mM EDTA, pH 7.4) and stored at -20°C.…”