A modular gene targeting system for sequential transgene stacking in plants

Kumar, Sandeep; Al-Abed, Diaa; Worden, Andrew; Novak, Stephen J.; Wu, Huixia; Ausmus, Carla; Beck, M. Van; Robinson, Heather; Minnicks, Tatyana; Hemingway, Daren; Lee, Ryan; Skaggs, Nicole; Wang, Lizhen; Marri, Pradeep Reddy; Gupta, Manju

doi:10.1016/j.jbiotec.2015.04.006

Cited by 37 publications

(27 citation statements)

References 36 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Northern blot results showed that expression of the nptII gene, the trait gene in our POC donor vector, in targeted lines was relatively uniform ( Supplementary Figure S10 ). This is consistent to other targeted studies that utilized site-specific recombinase such as Cre -lox, FLP -FRT and ZFN (Srivastava et al, 2004; Nandy and Srivastava, 2011; Kumar et al, 2015). Currently, we have designed new donor vectors which contains a trait gene of interest and trait genes in both targeted and random events will be compared.…”

Section: Discussionsupporting

confidence: 90%

Transcription Activator-Like Effector Nucleases (TALEN)-Mediated Targeted DNA Insertion in Potato Plants

et al. 2016

View full text Add to dashboard Cite

Targeted DNA integration into known locations in the genome has potential advantages over the random insertional events typically achieved using conventional means of genetic modification. Specifically integrated transgenes are guaranteed to co-segregate, and expression level is more predictable, which makes downstream characterization and line selection more manageable. Because the site of DNA integration is known, the steps to deregulation of transgenic crops may be simplified. Here we describe a method that combines transcription activator-like effector nuclease (TALEN)-mediated induction of double strand breaks (DSBs) and non-autonomous marker selection to insert a transgene into a pre-selected, transcriptionally active region in the potato genome. In our experiment, TALEN was designed to create a DSB in the genome sequence following an endogenous constitutive promoter. A cytokinin vector was utilized for TALENs expression and prevention of stable integration of the nucleases. The donor vector contained a gene of interest cassette and a promoter-less plant-derived herbicide resistant gene positioned near the T-DNA left border which was used to select desired transgenic events. Our results indicated that TALEN induced T-DNA integration occurred with high frequency and resulting events have consistent expression of the gene of interest. Interestingly, it was found that, in most lines integration took place through one sided homology directed repair despite the minimal homologous sequence at the right border. An efficient transient assay for TALEN activity verification is also described.

show abstract

Section: Discussionsupporting

confidence: 90%

Transcription Activator-Like Effector Nucleases (TALEN)-Mediated Targeted DNA Insertion in Potato Plants

et al. 2016

View full text Add to dashboard Cite

show abstract

“…Biplex quantitative PCR assay with GOI and a low copy maize endogenous gene, invertase (GenBank™ Accession No. U16123), was set up accordingly (Kumar et al 2015). The assay was prepared with 1X LightCycler ® 480 Probes Master in a 10 µL of volume reaction containing 0.1% of polyvinylpyrrolidone (PVP 40), 0.4 µM of each primer and 0.2 µM of each probe (For aad -1 detection: 5′ oligo: TGTTCGGTTCCCTCTACCAA; 3′ oligo: CAACATCCATCACCTTGACTGA; Probe: 6FAM-CACAGAACCGTCGCTTCAGCAACA-MGB; For yfp detection: 5′ oligo: CGTGTTGGGAAAGAACTTGGA; 3′ Oligo: CCGTGGTTGGCTTGGTCT; Probe: 6FAM-CACTCCCCACTGCCT-MGB; For Invertase : 5′ oligo: TGGCGGACGACGACTTGT; 3′ oligo: AAAGTTTGGAGGCTGCCGT; Probe: Hex-CGAGCAGACCGCCGTGTACTT-BHQ).…”

Section: Methodsmentioning

confidence: 99%

Comparison of the impact of viral and plant-derived promoters regulating selectable marker gene on maize transformation and transgene expression

Beringer¹,

Chen²,

Garton

et al. 2017

Plant Cell Rep

Self Cite

View full text Add to dashboard Cite

Key messageThe choice of promoter regulating the selectable marker gene impacts transformation efficiency, copy number and the expression of selectable marker and flanking genes in maize.AbstractViral or plant-derived constitutive promoters are often used to regulate selectable marker genes. We compared two viral promoters, cauliflower mosaic virus (CaMV 35T) and sugarcane bacilliform virus (SCBV) with two plant promoters, rice actin1 (OsAct1) and maize ubiquitin 1 (ZmUbi1) to drive aryloxyalkanoate dioxygenase (aad-1) selectable marker gene in maize inbred line B104. ZmUbi1- and OsAct1-containing constructs demonstrated higher transformation frequencies (43.8 and 41.4%, respectively) than the two viral promoter constructs, CaMV 35T (25%) and SCBV (8%). Interestingly, a higher percentage of single copy events were recovered for SCBV (82.1%) and CaMV 35T (59.3%) promoter constructs, compared to the two plant-derived promoters, OsAct1 (40.0%), and ZmUbi1 (27.6%). Analysis of protein expression suggested that the viral promoter CaMV 35T expressed significantly higher AAD-1 protein (174.6 ng/cm2) than the OsAct1 promoter (12.6 ng/cm2) in T0 leaf tissue. When measured in T2 callus tissue, the two viral promoters both had higher expression and more variability than the two plant-derived promoters. A potential explanation for why viral promoters produce lower transformation efficiencies but higher percentages of low copy number events is discussed. In addition, viral promoters regulating aad-1 were found to influence the expression of upstream flanking genes in both T0 leaf and T2 callus tissue.

show abstract

“…In the already mentioned study by Shukla et al (2009), transgenic maize plants were created by inserting the pat gene using ZFNs (see above). Similarly, Kumar et al (2015) have used ZFNs to heritably knock in the pat gene in maize. We found two studies that have focused on gene stacking.…”

Section: " 46mentioning

confidence: 99%

Genome Editing with Engineered Nucleases in Economically Important Animals and Plants: State of the Art in the Research Pipeline

2017

Current Issues in Molecular Biology

View full text Add to dashboard Cite

show abstract

A modular gene targeting system for sequential transgene stacking in plants

Cited by 37 publications

References 36 publications

Transcription Activator-Like Effector Nucleases (TALEN)-Mediated Targeted DNA Insertion in Potato Plants

Transcription Activator-Like Effector Nucleases (TALEN)-Mediated Targeted DNA Insertion in Potato Plants

Comparison of the impact of viral and plant-derived promoters regulating selectable marker gene on maize transformation and transgene expression

Genome Editing with Engineered Nucleases in Economically Important Animals and Plants: State of the Art in the Research Pipeline

Contact Info

Product

Resources

About