A new HDV mouse model identifies mitochondrial antiviral signaling protein (MAVS) as a key player in IFN-β induction

Suárez-Amarán, Lester; Usai, Carla; Scala, Marianna Di; Godoy, Cristina; Ni, Yi; Hommel, Mirja; Palomo, Laura; Segura, Víctor; Olagüe, Cristina; Vales, África; Ruiz-Ripa, Alicia; Buti, María; Salido, Eduardo; Prìeto, Jesús; Urban, Stephan; Rodríguez‐Frías, Francisco; Aldabe, Rafael; González‐Aseguinolaza, Gloria

doi:10.1016/j.jhep.2017.05.010

Cited by 54 publications

(114 citation statements)

References 39 publications

Supporting

Mentioning

105

Contrasting

Order By: Relevance

“…Recombinant AAV constructs AAV-HBV and AAV-HDV vectors were constructed as described. 22 As a control we used an AAV containing the luciferase gene (AAV-Luc). 22 The coding sequences for the S-HDAg was amplified using the primers: 5 0 -S-HDAg (5 0 -tttttggatccaccatgagccggtccgagtcggaggaagaacc-3 0 ), and 3 0 -S-HDAg (5 0 -aaaaaagatctctatggaaa tccctggttacccctg-3 0 ).…”

Section: Methodsmentioning

confidence: 99%

“…22 As a control we used an AAV containing the luciferase gene (AAV-Luc). 22 The coding sequences for the S-HDAg was amplified using the primers: 5 0 -S-HDAg (5 0 -tttttggatccaccatgagccggtccgagtcggaggaagaacc-3 0 ), and 3 0 -S-HDAg (5 0 -aaaaaagatctctatggaaa tccctggttacccctg-3 0 ). The coding sequence for L-HDAg was amplified using the primers 5 0 -S-HDAg and (5 0 -tttttagatcttcactggggtcgacaactctggggagaaaagggcggatcggcaggaaagagtatt acccatggaaatccc-3 0 ).…”

Section: Methodsmentioning

confidence: 99%

“…Site-directed mutagenesis was performed in the L-HDAg coding sequence to edit the STOP codon (position 196) to a tryptophan codon. Amplification products were inserted in the pAAV-MCS plasmid carrying the chimeric EAlb/AAT promoter 22 sequence to make the AAV-S-HDAg and AAV-L-HDAg vectors. The AAV genomes were packaged in AAV serotype 8capsids (AAV8) as previously described.…”

Section: Methodsmentioning

confidence: 99%

“…The AAV genomes were packaged in AAV serotype 8capsids (AAV8) as previously described. 22 Depletion of NK cells and macrophages Mice were NK-depleted by intraperitoneal (i.p.) administration of 500 lg of anti-mouse NK1.1 antibody (PK136, BioXcell) 2 days before virus injection and every 48 h until 20 days post-infection (dpi).…”

Section: Methodsmentioning

confidence: 99%

“…Recently, we developed a mouse model of HDV replication, based on adeno-associated viral vector (AAV)-mediated delivery of HBV and HDV replication-competent genomes to the liver, that mimics most of the features of severe acute HDV infection in humans, including the induction of liver inflammation and liver injury, which is associated with the expression of genes involved in the development of HCC, cirrhosis, fibrosis, and cell death. 22 The aim of this work was to determine the role of host and viral factors in HDV-mediated liver injury in this HDV-mouse model.…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

TNF-alpha inhibition ameliorates HDV-induced liver damage in a mouse model of acute severe infection

et al. 2020

Self Cite

View full text Add to dashboard Cite

Background & Aims: HDV infection induces the most severe form of human viral hepatitis. However, the specific reasons for the severity of the disease remain unknown. Recently, we developed an HDV replication mouse model in which, for the first time, liver damage was detected. Methods: HDV and HBV replication-competent genomes and HDV antigens were delivered to mouse hepatocytes using adeno-associated vectors (AAVs). Aminotransferase elevation, liver histopathology, and hepatocyte death were evaluated and the immune infiltrate was characterized. Liver transcriptomic analysis was performed. Mice deficient for different cellular and molecular components of the immune system, as well as depletion and inhibition studies, were employed to elucidate the causes of HDV-mediated liver damage. Results: AAV-mediated HBV/HDV coinfection caused hepatocyte necrosis and apoptosis. Activated T lymphocytes, natural killer cells, and proinflammatory macrophages accounted for the majority of the inflammatory infiltrate. However, depletion studies and the use of different knockout mice indicated that neither T cells, natural killer cells nor macrophages were necessary for HDV-induced liver damage. Transcriptomic analysis revealed a strong activation of type I and II interferon (IFN) and tumor necrosis factor (TNF)-a pathways in HBV/HDV-coinfected mice. While the absence of IFN signaling had no effect, the use of a TNF-a antagonist resulted in a significant reduction of HDV-associated liver injury. Furthermore, hepatic expression of HDAg resulted in the induction of severe liver damage, which was T cell-and TNF-a-independent. Conclusions: Both host (TNF-a) and viral (HDV antigens) factors play a relevant role in HDV-induced liver damage. Importantly, pharmacological inhibition of TNF-a may offer an attractive strategy to aid control of HDV-induced acute liver damage.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

TNF-alpha inhibition ameliorates HDV-induced liver damage in a mouse model of acute severe infection

et al. 2020

Self Cite

View full text Add to dashboard Cite

show abstract

Hepatitis D

Anastasiou

Wedemeyer

2020

Liver Immunology

View full text Add to dashboard Cite

Innate immunity in hepatitis B and D virus infection: consequences for viral persistence, inflammation, and T cell recognition

2021

View full text Add to dashboard Cite

Chronic infections with human hepatitis viruses continue to be a major health burden worldwide. Despite the availability of an effective prophylactic vaccine against the hepatitis B virus (HBV) and of antiviral agents efficiently suppressing HBV replication, more than 250 million people are currently chronically infected with this hepatotropic DNA virus, and resolution of chronic hepatitis B (CHB) is rarely achieved. Moreover, coinfection with the hepatitis D virus (HDV), a human RNA satellite virus requiring the envelope proteins of HBV for productive viral spreading, substantially aggravates the disease course of CHB. The molecular mechanisms by which these viruses interact with each other and with the intrinsic innate responses of the hepatocytes are not fully understood. While HBV appears to avoid innate immune recognition, HDV elicits a strong enhancement of innate responses. Notwithstanding, such induction does not hamper HDV replication but contributes to liver inflammation and pathogenesis. Intriguingly, HDV appears to influence the ability of T cells to recognize infected hepatocytes by boosting antigen presentation. This review focuses on current knowledge regarding how these viruses can shape and counteract the intrinsic innate responses of the hepatocytes, thus affecting the immune system and pathogenesis. Understanding the distinct strategies of persistence that HBV and HDV have evolved is central for advancing the development of curative therapies.

show abstract

A new HDV mouse model identifies mitochondrial antiviral signaling protein (MAVS) as a key player in IFN-β induction

Cited by 54 publications

References 39 publications

TNF-alpha inhibition ameliorates HDV-induced liver damage in a mouse model of acute severe infection

TNF-alpha inhibition ameliorates HDV-induced liver damage in a mouse model of acute severe infection

Hepatitis D

Innate immunity in hepatitis B and D virus infection: consequences for viral persistence, inflammation, and T cell recognition

Contact Info

Product

Resources

About