A new real-time PCR method for rapid and specific detection of ling ( Molva molva )

Taboada, Lucía; Sánchez, Arlex; Sotelo, Carmen G.

doi:10.1016/j.foodchem.2017.01.117

Cited by 16 publications

(5 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The results found that the apparent fluorescence signal can be observed in all eight Gadiformes species by adding genomic DNA at levels as low as 0.048 ng (Figure S1). This level was comparable to the LODs of previous studies on other authentication assays using SYBR Green real‐time method (Quek et al , ), but represented a less sensitivity compared with probe‐based real‐time PCR (Prado et al , ; Taboada et al , ). Nevertheless, several advantages, such as the simple design, easy set‐up and low cost, still make SYBR Green method a wide application on food fraud detection (Safdar & Junejo, ).…”

Section: Resultssupporting

confidence: 80%

“…As it has been widely discussed (Teletchea et al , ; Rasmussen & Morrissey, ; Böhme et al , ), both nuclear DNA (nDNA) and mitochondrial DNA (mtDNA) are suitable for fish species identification. Although the limitation in the applicability of quantitative approaches has been highlighted (Mohamad et al , ; Amaral et al , ), mtDNA is still preferentially chosen as the target in many studies for qualitative analysis (Prado et al , ; Taboada et al , ; Xiong et al , ), due to the advantages of high mutation rate, multi‐copy nature and maternal inheritance. Moreover, the candidate gene marker should have a high inter‐specific variability and display either low or no intra‐specific variations (Teletchea et al , ).…”

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

Development of a rapid method for codfish identification in processed fish products based on SYBR Green real‐time PCR

Xiong

Yuan

Huang

et al. 2019

Int J of Food Sci Tech

View full text Add to dashboard Cite

Summary Using species outside the order Gadiformes to prepare codfish products has been widely revealed as a new type of fraud in China, highlighting the necessity to establish proper methods for codfish species identification. This work aimed to develop a new SYBR Green real‐time PCR assay for the detection of codfish ingredient (mainly the eight Gadiformes species, Gadus morhua, Gadus macrocephalus, Theragra chalcogramma, Pollachius virens, Melanogrammus aeglefinus, Merluccius merluccius, Merluccius australis and Albatrossia pectoralis) in processed fish products based on mitochondrial 12S rRNA gene. Results highlighted the positive Cq (cycle quantification value, average value 19.18 ± 1.49) only from the eight Gadiformes species, with no fluorescent signal (Cq > 32) for the other sixty‐seven non‐Gadiformes species. The absolute limit of detection was 0.048 ng genomic DNA. Methodology validation succeeded in twenty‐six commercial products. These results demonstrated that the newly developed method is suitable for the identification of codfish ingredient in processed fish products.

show abstract

Section: Resultssupporting

confidence: 80%

Section: Resultsmentioning

confidence: 99%

Development of a rapid method for codfish identification in processed fish products based on SYBR Green real‐time PCR

Xiong

Yuan

Huang

et al. 2019

Int J of Food Sci Tech

View full text Add to dashboard Cite

show abstract

“…In addition, 10 of the samples did not include the scientific name on the label and appeared under the ambiguous name “cod” (Herrero et al., 2010). Taboada, Sánchez, Sotelo et al (2017) tested their assay on 31 commercially relevant ling ( Molva molva ) samples, of which 19.4% were mislabeled. In fact, three of the samples were substituted with other species, with two identified as lower‐value species ( Brosme brosme and Molva dypterigia ) and one identified as a higher‐value species ( Gadus morhua ) (Tabaoda, Sánchez, Sotelo et al., 2017).…”

Section: Fish Orders and Detection Methodsmentioning

confidence: 99%

Twenty‐three years of PCR‐based seafood authentication assay development: What have we learned?

Singh,

Young,

Hellberg

et al. 2024

Comp Rev Food Sci Food Safe

View full text Add to dashboard Cite

Seafood is a prime target for fraudulent activities due to the complexity of its supply chain, high demand, and difficult discrimination among species once morphological characteristics are removed. Instances of seafood fraud are expected to increase due to growing demand. This manuscript reviews the application of DNA‐based methods for commercial fish authentication and identification from 2000 to 2023. It explores (1) the most common types of commercial fish used in assay development, (2) the type of method used, (3) the gene region most often targeted, (4) provides a case study of currently published assays or primer‐probe pairs used for DNA amplification, for specificity, and (5) makes recommendations for ensuring standardized assay‐based reporting for future studies. A total of 313 original assays for the detection and authentication of commercial fish species from 191 primary articles published over the last 23 years were examined. The most explored DNA‐based method was real‐time polymerase chain reaction (qPCR), followed by DNA sequencing. The most targeted gene regions were cytb (cytochrome b) and COI (cytochrome c oxidase 1). Tuna was the most targeted commercial fish species. A case study of published tuna assays (n = 19) targeting the cytb region found that most assays were not species‐specific through in silico testing. This was conducted by examining the primer mismatch for each assay using multiple sequence alignment. Therefore, there is need for more standardized DNA‐based assay reporting in the literature to ensure specificity, reproducibility, and reliability of results. Factors, such as cost, sensitivity, quality of the DNA, and species, should be considered when designing assays.

show abstract

“…Mmol_Cytb‐R (reverse) 5′‐ATGTTAGTCCTCGTTGTTTAGAGGTATG‐3′) and minor groove binding TaqMan probe (Mmol_Cytb‐P [probe] 5′‐CTAGTTCTCATAGTAGTCCCCT‐3′). Statistically significant differences between Ct value obtained this species (19.45 ± 0.65) and the average Ct of nontarget species DNA (38.3 ± 2.8) (Taboad, 2017)…”

Section: Introductionmentioning

confidence: 96%

The use of molecular markers in the verification of fish and seafood authenticity and the detection of adulteration

Kotsanopoulos

Exadactylos

Gkafas

et al. 2021

Comp Rev Food Sci Food Safe

View full text Add to dashboard Cite

The verification of authenticity and detection of food mislabeling are elements that have been of high importance for centuries. During the last few decades there has been an increasing consumer demand for the verification of food identity and the implementation of stricter controls around these matters. Fish and seafood are among the most easily adulterated foodstuffs mainly due to the significant alterations of the species' morphological characteristics that occur during the different types of processing, which render the visual identification of the animals impossible. Even simple processes, such as filleting remove very important morphological elements and suffice to prevent the visual identification of species in marketed products. Novel techniques have therefore been developed that allow identification of species, the differentiation between species and also the differentiation of individuals that belong to the same species but grow in different populations and regions. Molecular markers have been used during the last few decades to fulfill this purpose and several improvements have been implemented rendering their use applicable to a commercial scale. The reliability, accuracy, reproducibility, and time‐and cost‐effectiveness of these techniques allowed them to be established as routine methods in the industry and research institutes. This review article aims at presenting the most important molecular markers used for the authentication of fish and seafood. The most important techniques are described, and the results of numerous studies are outlined and discussed, allowing interested parties to easily access and compare information about several techniques and fish/seafood species.

show abstract

A new real-time PCR method for rapid and specific detection of ling ( Molva molva )

Cited by 16 publications

References 34 publications

Development of a rapid method for codfish identification in processed fish products based on SYBR Green real‐time PCR

Development of a rapid method for codfish identification in processed fish products based on SYBR Green real‐time PCR

Twenty‐three years of PCR‐based seafood authentication assay development: What have we learned?

The use of molecular markers in the verification of fish and seafood authenticity and the detection of adulteration

Contact Info

Product

Resources

About