A new species ofPsychrophrynella(Amphibia, Anura, Craugastoridae) from the humid montane forests of Cusco, eastern slopes of the Peruvian Andes

Abstract

We describe a new species of Psychrophrynella from the humid montane forest of the Department Cusco in Peru. Specimens were collected at 2,670–3,165 m elevation in the Área de Conservación Privada Ukumari Llakta, Japumayo valley, near Comunidad Campesina de Japu, in the province of Paucartambo. The new species is readily distinguished from all other species of Psychrophrynella but P. bagrecito and P. usurpator by possessing a tubercle on the inner edge of the tarsus, and from these two species by its yellow ventral coloration on abdomen and limbs. Furthermore, the new species is like P. bagrecito and P. usurpator in having an advertisement call composed of multiple notes, whereas other species of Psychrophrynella whose calls are known have a pulsed call (P. teqta) or a short, tonal call composed of a single note. The new species has a snout-vent length of 16.1–24.1 mm in males and 23.3–27.7 mm in females. Like other recently described species in the genus, this new Psychrophrynella inhabits high-elevation forests in the tropical Andes and likely has a restricted geographic distribution.

A new species of Bryophryne (Anura: Strabomantidae) from the Cordillera de Vilcabamba, southeastern Peruvian Andes

“…In recent years the number of species of Terrarana inhabiting the Peruvian Andes has 2007, 2015, Lehr and Catenazzi 2008, 2010, Lehr and Oróz 2012Mamani and Malqui 2014, Chavez 2015, Catenazzi and Ttito 2016, contributing to high rates of species discovery for Peru (Catenazzi 2015). Many of these recent discoveries were made in previously unexplored areas, highlighting the The genus Bryophryne is an extreme example of these discovery patterns, because 13 of 14 known species have been discovered over the past 10 years, and because all species are highly endemic with their known geographic distributions restricted to their type localities and immediate surroundings.…”

Bryophryne phuyuhampatu sp. n., a new species of Cusco Andes frog from the cloud forest of the eastern slopes of the Peruvian Andes (Amphibia, Anura, Craugastoridae)

“…Standard protocols were used to extract, amplify and sequence the non-coding 16S rRNA mitochondrial fragment (Catenazzi and Ttito 2016), and new sequences were deposited in GenBank (Table 1). Variation in coloration was described on the basis of field notes and photographs of live frogs.…”

“…During May and June of 2015 and 2016 we explored two valleys of the eastern side of the Cordillera de Paucartambo within the Área de Conservación Privada Ukumari Llaqta (Catenazzi and Ttito 2016), a protected area recognized by a Peruvian environmental ministerial decree in 2011. This private area is owned and managed by local communities, whose members permitted our work and guided us through the high-elevation grasslands, montane scrub, and down to the higher reaches of the humid montane forest.…”

“…This private area is owned and managed by local communities, whose members permitted our work and guided us through the high-elevation grasslands, montane scrub, and down to the higher reaches of the humid montane forest. Our work in the Japumayo Valley in 2015 led to the discovery of Psychrophrynella chirihampatu (Catenazzi and Ttito 2016). In 2016 we surveyed the adjacent Quispillomayo Valley, where we found specimens of a new species of Bryophryne in the humid montane forest.…”

A new species of frog of the genus Pristimantis from Tingo María National Park, Huánuco Department, central Peru (Anura, Craugastoridae)

“…Sequences of closely related, congeneric species were downloaded from GenBank (Appendix 2). Extraction, amplification, and sequencing of DNA followed standard protocols (Hedges et al 2008; Catenazzi and Tito 2016). The 16Sar (forward) primer (5’-3’ sequence: CGCCTGTTTATCAAAAACAT) and the 16Sbr (reverse) primer (5’-3’ sequence: CCGGTCTGAACTCAGATCACGT) (Palumbi et al 2002) were used; the following thermocycling conditions during the polymerase chain reaction (PCR) with a Veriti thermal cycler (Applied Biosystems) were employed: one cycle of 96 °C/3 min; 35 cycles of 95 °C/30 s, 55 °C/45 s, 72 °C/1.5 min; one cycle 72 °C/7 min.…”