A novel bicistronic vector for overexpressing Mycobacterium tuberculosis proteins in Escherichia coli

Abstract

A putative DNA glycosylase encoded by the Rv3297 gene (MtuNei2) has been identified in Mycobacterium tuberculosis. Our efforts to express this gene in Escherichia coli either by supplementing tRNAs for rare codons or optimizing the gene with preferred codons for E. coli resulted in little or no expression. On the other hand, high-level expression was observed using a bicistronic expression vector in which the target gene was translationally coupled to an upstream leader sequence. Further comparison of the predicted mRNA secondary structures supported the hypothesis that mRNA secondary structure(s) surrounding the translation initiation region (TIR), rather than codon usage, played the dominant role in influencing translation efficiency, although manipulation of codon usage or tRNA supplementation did further enhance expression in the bicistronic vector. Addition of a cleavable N-terminal tag also facilitated gene expression in E. coli, possibly through a similar mechanism. However, since cleavage of N-terminal tags is determined by the amino acid at the P 1 ′ position downstream of the protease recognition sequence and results in the addition of an extra amino acid in front of the N-terminus of the protein, this strategy is not particularly amenable to Fpg/Nei family DNA glycosylases which carry the catalytic proline residue at the P 1 ′ position and require a free N-terminus. On the other hand, the bicistronic vector constructed here is potentially valuable particularly when expressing proteins from G/C rich organisms and when the proteins carry proline residues at the N-terminus in their native form. Thus the bicistronic expression system can be used to improve translation efficiency of mRNAs and achieve high-level expression of mycobacterial genes in E. coli.

Expression and purification of active mouse and human NEIL3 proteins

“…In order to overcome translational inhibition of mRNAs with stable secondary structures, a bicistronic expression system developed in our lab [34] was used to achieve high-level expression of the mouse and human Neil3 genes in E. coli . First, an expression vector based on the pET30a plasmid in which a leader sequence, ORF6, preceded the cloned full-length MmuNeil3 gene was constructed (Fig.…”

“…Details of the construction of the pET30a-ORF6 vector and the sequence of the ORF6 leader sequence have been previously described [34]. To create the pETDuet2- T7EcoMapY168A-ORF6 vector, we first amplified the EcoMapY168A gene from pBS-Map(Y168A)-cGSTM1 plasmid (kindly provided by Dr. Ming F. Tam, Institute of Molecular Biology, Academia Sinica, [32]) using the following primers: 5′catgccatggc tatctcaatcaagacccc3′ and 5′acgcgtcgacttattcgtcgtgcgagattatcgc3′.…”

“…E. coli bicistronic expression vectors, constructed in our laboratory, that contain an ORF6 leader sequence [34] were used to increase translation efficiency and EcoMapY168A was co-expressed with the Neil3 proteins under the control of separate T7/ lac promoters. Whether co-expression of EcoMapY168A facilitates the N-terminal methionine processing and enhances the percentage of the active Neil3 proteins in the preparation was examined.…”

The oxidative DNA glycosylases of Mycobacterium tuberculosis exhibit different substrate preferences from their Escherichia coli counterparts

“…The genes encoding MtuFpg1 ( Rv2924c ) and MtuFpg2 ( Rv0944 ) were individually cloned between the EcoRV and XhoI sites of the bicistronic vector pET30a-ORF6, as previously described to allow active expression of the C-terminal hexa-his tagged proteins [24]. In order to avoid the potential inhibitory effect of rare codons during translation, the pRARE2 plasmid (Novagen, Madison, WI) carrying seven rare-codon tRNA genes (GGA, CUA, AUA, CCC, AGG, AGA, CGG) was co-transformed with each expression plasmid into E. coli ER2566 (Fpg-).…”

A bicistronic vector with destabilized mRNA secondary structure yields scalable higher titer expression of human neurturin in E. coli

“…The RBS (ribosome binding site) and the start codon, if sequestered in a structured region of the mRNA, can decrease accessibility for ribosomes and diminish translation. The coding sequence of NTN is translationally coupled to the upstream cistron, keeping expression of NTN dependent on the efficiency of translation of the first cistron (Guo et al, 2009). Thus, our third approach focused on the TIR region where we designed a bicistronic vector with an A/Trich sequence containing first cistron encoded upstream of the second NTN cistron to minimize locally stabilized mRNA secondary structure and enable efficient translation initiation.…”