A Novel Function of MicroRNA Let‐7d in Regulation of Galectin‐3 Expression in Attention Deficit Hyperactivity Disorder Rat Brain

Abstract

In this study we investigated the locomotor activity and non-selective attention in spontaneously hypertensive rats (SHR) with control Wistar-Kyoto (WKY) rats, which were employed as an attention deficit hyperactivity disorder (ADHD) model. In open-field test and làt maze, SHR rats were found to be much more spontaneously active than WKY rats. As compared with WKY rats, a lower level of galectin-3 was observed in SHR brain prefrontal cortex (PFC), which was the major affected brain area of ADHD. Through miRNA microarray screening, rno-let-7d was noted to be solely upregulated in SHR PFC. Interestingly, rno-let-7d had a binding site at galectin-3 mRNA and was shown to regulate galectin-3 3' untranslated region (UTR) directly. Mutation of galectin-3 3'UTR by one nucleotide of the seed sequence prevented rno-let-7d regulation of the 3' UTR completely. Although rno-let-7d did not directly regulate tyrosine hydroxylase (TH) 3'UTR, the level of galectin-3 was important for cAMP response element binding protein, the major transcript factor for TH gene. Either overexpression or downexpression of galectin-3 could result in modulation of TH expression in both PC12H and PC12L cells. In conclusion, our data suggested a novel function of rno-let-7d in regulation of galectin-3 and in ADHD development. Rno-let-7d, which is increased in the PFC of SHR brain, negatively regulated galectin-3, which is coupled with TH expression regulation.

MiR-301a Mediates the Effect of IL-6 on the AKT/GSK Pathway and Hepatic Glycogenesis by Regulating PTEN Expression

“…The intensity of the green signal was calculated after the subtraction of background, as well as averaging of four replicated spots of each probe on the same slide. Median normalization method was used to obtain “Normalized Data”: Normalized Data= (Foreground-Background) / Median, where the median was the 50% quartile of miRNA intensity, which was larger than 50 in all samples after correction for background [25]. …”

MiR-223 Suppresses Cell Proliferation by Targeting IGF-1R

“…50 nM miRNA specific stem-loop RT primers [27] were used for reverse transcription reaction as the following. 5′GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGGGT 3′ for miR-223 and 5′AAAATATGGAACGCT 3′ for the loading control RNU6, and quantitative PCR to detect mature miR-223 with specific primers was performed with 2× SYBR Green Master Mix (DBI Bioscience, Shanghai, China) according to the protocol as our previous report[28]. The primers used in this experiment are as the following: 5′GTGCAGGGTCCGAGGT3′ and 5′CGGGCTGTCAGTTTGTCA3′ for miR-223; 5′CTCGCTTCGGCAGCACA 3′ and 5′AACGCTTCACGAATTTGCGT 3′ for RNU6; …5′GAGCTACGAGCTGCCTGACG3′ and 5′CCTAGAAGCATTTGCGGTGG3′ for loading control β-actin; 5′TGAACAGAATGGAATGGAGC3′and 5′ACTTTCATCCATTGATTGCC3′ for HIF-1α; 5′TTATGTTCTTTTTCCCCCTT3′ and 5′ TGCCCACAAATTATCTTCTATC3′ for p70S6K; 5′ GGACAGGTCAGAGGGTTTC and 5′CTCGTAACTCTTCTCTGTGCC3′ for IGF-1R-1; 5′ATTCCAGCAGTCCCAGTTAT3′ and 5′CATCTCCCAATGCTGCTTAG3′ for IGF-1R-2; 5′ GCAACCGACGATTCTTCTAC3′ and 5′TCGAGCTGTTTACGTTTGAC3′ for p27; 5′TACTACCGCCTCACACGC3′ and 5′CTCCTCCTCCTCCTCTTCCT 3′ for cyclin D1; 5′GGCTTCAGAAATACTTCCACC3′ and 5′ GCAGGACAGATGAGTCGAAG 3′for Rasa1; 5′ TGGGACTTGAGTGGTTTGTAG3′ and 5′CAGTTTAGGTTGCTACAGGCT3′ for Fox O1; 5′CTGAGGAAGGGGAAGTGG3′ and 5′ GTAAACGGTATCACTGTCCACT3′ for Fox O3; 5′ ACATTAGTGGGACATACAGGTG3′ and 5′CATACAACGCACAGTGGAAGT3′ for FBXW7.…”

Role of apoptosis genes in aggression revealed using combined analysis of ANDSystem gene networks, expression and genomic data in grey rats with aggressive behavior

“…Галектин-3 участвует во многих биологических процессах, включая врожденный иммунитет, клеточную адгезию, регуляцию функции Т-клеток и микроглии (Chip et al, 2017). Показано, что галектин-3 регулирует бе лок CREB, который является фактором транскрипции гена Th, и повышенная экспрессия гена Lgals3 приводит к уве-личению экспрессии гена Th (Wu et al, 2010). Известно, что Jun, Angt, Cdk5, Ngf, Ptx3, Nr4A2, Trka, Cntf, P53, IL1B, Egr1 могут положительно регулировать экспрессию гена Th или активность его продукта (Kansy et al, 2004;Dorofeeva et al, 2013).…”