A novel l-isoleucine metabolism in Bacillus thuringiensis generating (2S,3R,4S)-4-hydroxyisoleucine, a potential insulinotropic and anti-obesity amino acid

Abstract

4-Hydroxyisoleucine (HIL) found in fenugreek seeds has insulinotropic and anti-obesity effects and is expected to be a novel orally active drug for insulin-independent diabetes. Here, we show that the newly isolated strain Bacillus thuringiensis 2e2 and the closely related strain B. thuringiensis ATCC 35646 operate a novel metabolic pathway for L-isoleucine (L-Ile) via HIL and 2-amino-3-methyl-4-ketopentanoic acid (AMKP). The HIL synthesis was catalyzed stereoselectively by an α-ketoglutaric acid-dependent dioxygenase and to be useful for efficient production of a naturally occurring HIL isomer, (2S,3R,4S)-HIL. The (2S,3R,4S)-HIL was oxidized to (2S,3R)-AMKP by a NAD(+)-dependent dehydrogenase. The metabolic pathway functions as an effective bypass pathway that compensates for the incomplete tricarboxylic acid (TCA) cycle in Bacillus species and also explains how AMKP, a vitamin B(12) antimetabolite with antibiotic activity, is synthesized. These novel findings pave a new way for the commercial production of HIL and also for AMKP.

Characterization of Bacillus thuringiensis l -Isoleucine Dioxygenase for Production of Useful Amino Acids

“…Also, detailed kinetic analysis of sulfoxidation by IDO would be needed to determine whether this reaction has physiological significance in B. thuringiensis 2e2 cells. On the other hand, IDO dehydrogenated (2S,3R,4S)-HIL into (2S,3R)-AMKP, but this activity has no physiological significance, because the specific activity of IDO was very low toward HIL and this conversion was strongly carried out by a NAD ϩ -dependent HIL dehydrogenase in B. thuringiensis 2e2 (23).…”

“…The 6ϫHis-tagged IDO-expressing strain E. coli Rosetta2(DE3) carrying pET-IDO (2e2) was constructed by a method similar to that in our previous report (23), except for the primer set used: CATATGAAAATGAGTGGCTTTAGCATAGAA and CTCGAGTTTTGTCT CCTTATAAGAAAATGT. The recombinant IDO was heterologously expressed in the strain and purified in the same manner as in the previous report (23). After checking the homogeneity by SDS-PAGE (see Fig.…”

“…In our previous research, it was found that Bacillus thuringiensis 2e2 possessed a novel L-isoleucine (L-Ile) metabolic pathway involving the hydroxylation of L-Ile to (2S,3R,4S)-HIL and further oxidation to (2S,3R)-2-amino-3-methyl-4-ketopentanoate (AMKP), which is known as a vitamin B 12 antimetabolite (27). The former reaction of the pathway was catalyzed by an ␣-ketoglutarate (␣KG)-dependent L-Ile dioxygenase (IDO) (18) and the latter by a NAD ϩ -dependent HIL dehydrogenase (23). In addition, we developed an efficient production system for HIL using Escherichia coli cells heterologously expressing IDO (31).…”

4-Hydroxyisoleucine production of recombinant Corynebacterium glutamicum ssp. lactofermentum under optimal corn steep liquor limitation

“…Assay of the L-isoleucine dioxygenase activity IDO activity was assayed by a stop method as described by Ogawa et al (2011) with some modifications. In brief, a reaction mixture (1.0 mL) consisting of 200 mM Na 2 HPO 4 -citrate buffer (pH 6.0), 30 mM Ile, 30 mM KG, 1 mM FeSO 4 , 5 mM ascorbic acid, and an appropriate amount of enzyme was incubated at 40°C for 30 min.…”

“…Therefore, a more efficient method for biosynthesis of 4-HIL is desirable. Recently, a new enzymatic method based on Bacillus thuringiensis-derived L-isoleucine dioxygenase (IDO) was reported for direct biosynthesis of 4-HIL from Lisoleucine (Ile) (Kodera et al 2009;Ogawa et al 2011;Hibi et al 2011). IDO catalyzes the C-4 hydroxylation of Ile to form 4-HIL with the concomitant oxidation of α-ketoglutarate (KG) to form succinate.…”