A novel luciferase fusion protein for highly sensitive optical imaging: from single-cell analysis to in vivo whole-body bioluminescence imaging

Mezzanotte, Laura; Blankevoort, Vicky; Löwik, Clemens W.G.M.; Kaijzel, Eric L.

doi:10.1007/s00216-014-7917-2

Cited by 23 publications

(19 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The TurboLuc vector [Mezzanotte et al., ], expressing a dual reporter gene resulting from the fusion between luciferase and the red fluorescent protein TurboFP635, was modified inserting a linker coding for the p.A22T or WT sequence of the EMILIN‐1 signal peptide with the NheI recognition site (5‐GCTAGCCGCCACCATGGCCCCCCGCACCCTCTGGAGCTGCTACCTCTGCTGCCTGCTGACGGCAGCTGCAGGGGCCRCCAGCAGGCTAGC‐3), with R meaning G or A and the NheI recognition sites underlined. The linker was ligated in the NheI restriction site of TurboLuc vector, in frame with the N‐terminal end of the luciferase‐coding sequence.…”

Section: Methodsmentioning

confidence: 99%

Diagnostic Exome Sequencing Identifies a Novel Gene,EMILIN1, Associated with Autosomal‐Dominant Hereditary Connective Tissue Disease

et al. 2015

View full text Add to dashboard Cite

Heritable connective tissue diseases are a highly heterogeneous family of over 200 disorders that affect the extracellular matrix. While the genetic basis of several disorders is established, the etiology has not been discovered for a large portion of patients, likely due to rare yet undiscovered disease genes. By performing trio‐exome sequencing of a 55‐year‐old male proband presenting with multiple symptoms indicative of a connective disorder, we identified a heterozygous missense alteration in exon 1 of the Elastin Microfibril Interfacer 1 (EMILIN1) gene, c.64G>A (p.A22T). The proband presented with ascending and descending aortic aneurysms, bilateral lower leg and foot sensorimotor peripheral neuropathy, arthropathy, and increased skin elasticity. Sanger sequencing confirmed that the EMILIN1 alteration, which maps around the signal peptide cleavage site, segregated with disease in the affected proband, mother, and son. The impaired secretion of EMILIN‐1 in cells transfected with the mutant p.A22T coincided with abnormal protein accumulation within the endoplasmic reticulum. In skin biopsy of the proband, we detected less EMILIN‐1 with disorganized and abnormal coarse fibrils, aggregated deposits underneath the epidermis basal lamina, and dermal cells apoptosis. These findings collectively suggest that EMILIN1 may represent a new disease gene associated with an autosomal‐dominant connective tissue disorder.

show abstract

Section: Methodsmentioning

confidence: 99%

Diagnostic Exome Sequencing Identifies a Novel Gene,EMILIN1, Associated with Autosomal‐Dominant Hereditary Connective Tissue Disease

et al. 2015

View full text Add to dashboard Cite

show abstract

“…The majority of BRET reporters are designed with Renilla luciferase ( RLuc ) and variants thereof, which serve as the donor molecule to a yellow fluorescent acceptor molecule, although firefly luciferase ( FLuc ) BRET fusions have also been made. While several BRET reporter fusions have been described, these reporters suffer from sub-optimal acceptor activation, due to the poor overall levels and kinetics of light production generated by most luciferases, which is in part due to auto-inactivation by enzymatic by-products (4,21–28). To overcome these challenges, we utilized the enhanced small luciferase subunit (NanoLuc) of the deep-sea shrimp Oplophorus gracilirostris , which displays extremely bright, stable, glow-type luminescent properties and physical stability, with >150-fold brighter luminescence compared to firefly and renilla luciferases and >2 hours signal half-life (6,29).…”

Section: Introductionmentioning

confidence: 99%

Fluorophore-NanoLuc BRET Reporters Enable Sensitive In Vivo Optical Imaging and Flow Cytometry for Monitoring Tumorigenesis

et al. 2015

View full text Add to dashboard Cite

Fluorescent proteins are widely used to study molecular and cellular events, yet this traditionally relies on delivery of excitation light, which can trigger autofluorescence, photoxicity, and photobleaching, impairing their use in vivo. Accordingly, chemiluminescent light sources such as those generated by luciferases have emerged, as they do not require excitation light. However, current luciferase reporters lack the brightness needed to visualize events in deep tissues. We report the creation of chimeric eGFP-NanoLuc (GpNLuc) and LSSmOrange-NanoLuc (OgNLuc) fusion reporter proteins coined LumiFluors, which combine the benefits of eGFP or LSSmOrange fluorescent proteins with the bright, glow-type bioluminescent light generated by an enhanced small luciferase subunit (NanoLuc) of the deep sea shrimp Oplophorus gracilirostris. The intramolecular bioluminescence resonance energy transfer (BRET) that occurs between NanoLuc and the fused fluorophore generates the brightest bioluminescent signal known to date, including improved intensity, sensitivity and durable spectral properties, thereby dramatically reducing image acquisition times and permitting highly sensitive in vivo imaging. Notably, the self-illuminating and bi-functional nature of these LumiFluor reporters enables greatly improved spatio-temporal monitoring of very small numbers of tumor cells via in vivo optical imaging and also allows the isolation and analyses of single cells by flow cytometry. Thus, LumiFluor reporters are inexpensive, robust, non-invasive tools that allow for markedly improved in vivo optical imaging of tumorigenic processes.

show abstract

“…However, currently used constructs are limited by emission spectra of donor luciferases that are commonly selected for their development (e.g., Renilla luciferase (RLuc) and Firefly luciferase (FLuc)). For that reason, recently published constructs in that category cover only the spectral region from 474 nm of CNL5 to 635 nm of TurboRFP78. The superior probe for in vivo application therefore should not only merge the benefits of increased sensitivity of bioluminescence with the higher spatial and temporal resolution of fluorescence, but also have a near-infrared-shifted emission spectrum.…”

mentioning

confidence: 99%

Near-infrared bioluminescent proteins for two-color multimodal imaging

Rumyantsev

Turoverov

Verkhusha

2016

Sci Rep

View full text Add to dashboard Cite

Bioluminescence imaging became a widely used technique for noninvasive study of biological processes in small animals. Bioluminescent probes with emission in near-infrared (NIR) spectral region confer the advantage of having deep tissue penetration capacity. However, there are a very limited number of currently available luciferases that exhibit NIR bioluminescence. Here, we engineered two novel chimeric probes based on RLuc8 luciferase fused with iRFP670 and iRFP720 NIR fluorescent proteins. Due to an intramolecular bioluminescence resonance energy transfer (BRET) between RLuc8 and iRFPs, the chimeric luciferases exhibit NIR bioluminescence with maxima at 670 nm and 720 nm, respectively. The 50 nm spectral shift between emissions of the two iRFP chimeras enables combined multicolor bioluminescence imaging (BLI) and the respective multicolor fluorescence imaging (FLI) of the iRFPs. We show that for subcutaneously implanted cells, NIR bioluminescence provided a 10-fold increase in sensitivity compared to NIR FLI. In deep tissues, NIR BLI enabled detection of as low as 104 cells. Both BLI and FLI allowed monitoring of tumor growth and metastasis from early to late stages. Multimodal imaging, which combines concurrent BLI and FLI, provides continuous spatiotemporal analysis of metastatic cells in animals, including their localization and quantification.

show abstract

A novel luciferase fusion protein for highly sensitive optical imaging: from single-cell analysis to in vivo whole-body bioluminescence imaging

Cited by 23 publications

References 30 publications

Diagnostic Exome Sequencing Identifies a Novel Gene,EMILIN1, Associated with Autosomal‐Dominant Hereditary Connective Tissue Disease

Diagnostic Exome Sequencing Identifies a Novel Gene,EMILIN1, Associated with Autosomal‐Dominant Hereditary Connective Tissue Disease

Fluorophore-NanoLuc BRET Reporters Enable Sensitive In Vivo Optical Imaging and Flow Cytometry for Monitoring Tumorigenesis

Near-infrared bioluminescent proteins for two-color multimodal imaging

Contact Info

Product

Resources

About