A novel partial modification at C2501 in Escherichia coli 23S ribosomal RNA

Abstract

Escherichia coli is the best-characterized organism with respect to posttranscriptional modifications of its ribosomal RNA (rRNA). It is presently believed that all the modified nucleotides have been identified, primarily on the basis of two detection methods; modification-induced inhibition of the enzyme reverse transcriptase or analysis by combined HPLC and electrospray ionization mass spectrometry. Comparison of data from these different approaches reveals a disagreement regarding modification of C2501 in E. coli 23S rRNA. A. Bakin and J. Ofengand previously reported the detection of a modification at this site based on a reverse transcriptase assay. J.A. McCloskey and coworkers could not confirm the existence of such a modification using an electrospray ionization mass spectrometry approach. C2501 is therefore generally considered unmodified. We have used a strategy involving isolation of a specific rRNA fragment from E. coli 23S rRNA followed by Matrix Assisted Laser Desorption/Ionization mass spectrometry and tandem mass spectrometry to investigate this controversy. Our data reveal a novel 16-Da partial modification at C2501. We believe that the data reported here clarify the above discrepancy, because a minor partial modification detected in a reverse transcriptase assay would not necessarily be detected by the original mass spectrometry approach. The level of modification was furthermore monitored in different growth situations, and we found a significant positive regulation in stationary phase cells. C2501 is universally conserved and implicated in structure folds very close to the catalytic center of the ribosome. Moreover, several antibiotics bind to nucleotides in this region, which altogether make a modification at this site interesting.

Specificity shifts in the rRNA and tRNA nucleotide targets of archaeal and bacterial m5U methyltransferases

“…The sequences from G725-C767 and U1917-C1962 were isolated by hybridization to the complementary deoxyoligonucleotides 59-GCCCGGGGTCACGGGAGCGAACTGC ACATCAGCACCCCTAGCGGGCCTCC and 59-GCAGGTCGGC ATTTAACCGACAGGAATTTCGCTACCTTAAGAGGGTTA, respectively (Andersen et al 2004;Auxilien et al 2007). Briefly, 100 pmol of total rRNA was heated with 400 pmol of deoxyoligonucleotide at 85°C for 1 min, followed by slow cooling to 45°C over 2 h. Regions of the rRNAs that were not protected by hybridization were digested away with mung bean nuclease (NE Biolabs) and RNase A (Sigma), and the rRNA sequences paired to the deoxyoligonucleotide were separated by gel electrophoresis and were extracted.…”

Aminoglycoside resistance 16S rRNA methyltransferases block endogenous methylation, affect translation efficiency and fitness of the host

“…The 16S rRNA sequence from C1378 to G1432 was isolated by hybridization to a complementary 55-mer deoxyoligonucleotide as described ( Fig. 1; Andersen et al 2004). Fifty picomoles of total rRNA was incubated with 500 pmol of the deoxyoligonucleotide for 5 min at 70°C in 100 µL of hybridization buffer (250 mM HEPES, 500 mM KCl at pH 7.0), followed by slow cooling over 2 h to 45°C.…”

“…Fifty picomoles of total rRNA was incubated with 500 pmol of the deoxyoligonucleotide for 5 min at 70°C in 100 µL of hybridization buffer (250 mM HEPES, 500 mM KCl at pH 7.0), followed by slow cooling over 2 h to 45°C. Unhybridized rRNA was digested with 20 units of Mung bean nuclease and 0.5 µg of RNase A, and the rRNA fragment protected by the deoxyoligonucleotide was isolated by gel electrophoresis as described (Andersen et al 2004). Finally, 1 µg of the rRNA fragment was digested with 20 units of RNase T1 for 4 h at 37°C in 10 µL and 5 µL of 0.5 M 3-hydroxypicolinic acid (3-HPA) or with 2 µg of RNase A for 4 h at 37°C in 10 µL and 5 µL of 100 mM NH 4 OAc.…”

Multi-site-specific 16S rRNA methyltransferase RsmF from Thermus thermophilus

“…rRNA was ethanol precipitated and dissolved in water. Purification of 16S rRNA subfragments was performed as previously described (Andersen et al 2004). Briefly, 16S rRNA was hybridized to an excess of oligodeoxynucleotide complementary to either the region 944-990 or the region 1378-1432.…”