A Novel Phytomyxean Parasite Associated with Galls on the Bull-Kelp Durvillaea antarctica (Chamisso) Hariot

Abstract

Durvillaea antarctica (Fucales, Phaeophyceae) is a large kelp of high ecological and economic significance in the Southern Hemisphere. In natural beds along the central coast of Chile (Pacific Ocean), abnormal growth characterized by evident gall development and discolorations of the fronds/thallus was observed. Analysing these galls by light microscopy and scanning electron microscopy revealed the presence of endophytic eukaryotes showing typical characteristics for phytomyxean parasites. The parasite developed within enlarged cells of the subcortical tissue of the host. Multinucleate plasmodia developed into many, single resting spores. The affiliation of this parasite to the Phytomyxea (Rhizaria) was supported by 18S rDNA data, placing it within the Phagomyxida. Similar microorganisms were already reported once 23 years ago, indicating that these parasites are persistent and widespread in D. antarctica beds for long times. The symptoms caused by this parasite are discussed along with the ecological and economic consequences. Phytomyxean parasites may play an important role in the marine ecosystem, but they remain understudied in this environment. Our results demonstrate for the first time the presence of resting spores in Phagomyxida, an order in which resting spores were thought to be absent making this the first record of a phagomyxean parasite with a complete life cycle so far, challenging the existing taxonomic concepts within the Phytomyxea. The importance of the here described resting spores for the survival and ecology of the phagomyxid parasite will be discussed together with the impact this parasite may have on ‘the strongest seaweed of the world’, which is an important habitat forming and economic resource from the Southern Hemisphere.

Gall-forming protistan parasites infect southern bull kelp across the Southern Ocean, with prevalence increasing to the south

“…All sampling occurred in late spring and summer 2015/16. For visual quantification of infections in the field (Australia and Chile only), morphological identification of galls was based on descriptions in Aguilera et al (1988), Jahnke (1978) and Goecke et al (2012). Infection prevalence was quantified along a series of 10 m transects.…”

“…PCR amplification was conducted in a 20 µl solution, comprising 12.5 µl MilliQ water, 0.2 µl each of forward and reverse 10 mM primers, 4 µl of 1 mM dNTPS, 0.1 µl of PerfectTaq polymerase, 2 µl of PerfectTaq buffer (5Prime) and 1 µl of diluted DN A extraction. Maullinia-specific primers that would not amplify host DN A were used: Mau2F (5' ACGGGTACGAGGGACGTGGG) and Mau9R (5' TGCATCAG TGTAGCGAGCGT) (Goecke et al 2012). These primers amplified part of the 18S nuclear ribosomal gene, which is used for taxonomic identifications, descriptions of variation between populations of differing geographical origin and analyses of protist phylogenetic relationships (Pawlowski et al 2012, Hadziavdic et al 2014, Wang et al 2014).…”

“…These primers amplified part of the 18S nuclear ribosomal gene, which is used for taxonomic identifications, descriptions of variation between populations of differing geographical origin and analyses of protist phylogenetic relationships (Pawlowski et al 2012, Hadziavdic et al 2014, Wang et al 2014). PCRs were run in an Eppendorf Mastercycler (Epgradient S) using the Maullinia Touchdown protocol of Goecke et al (2012). PCR products were purified using a QIAQuick PCR Purification Kit (Qiagen) to be sent for sequencing at the University of Otago's Genetic Analysis Services (Otago, N ew Zealand), using an Ap plied Biosystems 3730xl capillary sequencer (Thermo Fisher Scientific).…”

“…The only Maullinia recorded on Durvillaea appears likely to be a newly recognised species ('Maullinia sp.' in Goecke et al 2012;now M. braseltonii: Murúa et al 2017). Although Australian Durvillaea populations have not yet been confirmed to host Maullinia, galls resembling those of the parasite were observed at Sorrento in southern Australia several decades ago (Jahnke 1978), and samples of M. ectocarpii were confirmed by Maier et al (2000) on local populations of Ectocarpus siliculosus.…”

“…Maullinia is a recently identified genus of phytomyxean parasite that can infect several brown algal genera including Macrocystis, Ectocarpus and Acineto spora (Maier et al 2000, Goecke et al 2012. The microscopic organisms produce motile zoospores which disperse and infect new hosts, causing galllike hypertrophies of host tissue (N euhauser et al 2011).…”