A Polymerase Chain Reaction–Based Method for the Detection of Hepatitis A Virus in Produce and Shellfish

Abstract

Outbreaks of gastroenteritis that are suspected to be of viral origin are on the rise. Thus, there is a need for regulatory agencies entrusted with food safety to develop adequate techniques for the detection of viruses in foods. We have established a general procedure for the detection of hepatitis A virus (HAV) in shellfish that, with minor modifications, is also applicable to fresh produce such as cilantro. Total RNA was isolated from shellfish or cilantro, followed by isolation of poly(A)-containing RNA. Because HAV genomic RNA contains a poly(A) tail, the isolation of poly(A)-containing RNA also enriches HAV genomic RNA. Reverse transcription was used to convert the RNA to cDNA, and then amplification was carried out by polymerase chain reaction (PCR). Reamplification with internal primers was used to improve the quality and the quantity of amplified DNA, allowing for post-PCR analysis such as sequence identification of the viral strain. With this procedure, multiple samples could be analyzed in four working days by a single trained individual. The nominal sensitivity of detection of the procedure was 0.15 TCID50 (50% tissue culture infective dose) per 0.62 g of tissue with a test virus. The direct RNA isolation protocol avoided pitfalls associated with whole-virus purification procedures by replacing virus precipitation steps involving polyethylene glycol and Procipitate with phenol extraction. The method is straightforward and reliable. We successfully used this procedure to detect naturally occurring HAV in clams involved in a gastroenteritis outbreak, as well as in cilantro artificially contaminated with a test virus.

Apoptosis induced by a cytopathic hepatitis A virus is dependent on caspase activation following ribosomal RNA degradation but occurs in the absence of 2′–5′ oligoadenylate synthetase

“…Virus stocks were prepared as described before (Kulka et al, 2003). 18f was titered by plaque assay, while clone 1 virus was titered by EIA in 96-well plates as described previously (Goswami et al, 2002) using the HAVAB EIA Diagnostic Kit (Abbott Laboratories, Abbott Park, IL). Human IFN-␤ and the pancaspase inhibitor Z-VAD-FMK were obtained from Sigma (St. Louis, MO).…”

“…The cells were maintained by routine subculturing in the same manner as for normal FrhK4 cells. To monitor virus replication, cells were periodically seeded into 12-well plates along with uninfected cells, and viral antigen in methanol fixed cells measured by the HAVAB EIA procedure (Goswami et al, 2002;Kulka et al, 2003). All experiments with this cell line (hereafter referred to as clone 1) were carried out between 6 months and 1 year of routine subculture.…”

“…The annealing temperature was 60 • C. Viral RNA in total or cytoplasmic RNA samples were amplified using primers 5 CCGTTTGCCTAGGCTATAGGCTA3 (sense) and 5 CAGCTCCATGCTAATCATGGAGT3 (antisense). This primer pair is directed to the 5 end of the HAV genome and can differentiate between the genomes of 18f and clone 1 strains of HAV based on the presence of an additional 14 bases in the 5 NTR of the 18f genome (Goswami et al, 2002;Kulka et al, 2003). All PCR amplifications were carried out in a total volume of 50 l, and contained 2-5 l of the cDNA pool, 2.5 mM MgCl 2 , 200 M of each deoxynucleoside triphosphate, 50 pmol of each primer, and 2 U of Taq DNA polymerase (Promega) for 30-35 cycles.…”

“…Confluent cultures of FrhK4 cells in 12-well plates were infected with 18f at 0.2, 1, or 5 pfu/cell, as described previously. Replication of virus was assessed by the level of viral antigen in each well as described before using the HAVAB EIA kit (Goswami et al, 2002;Kulka et al, 2003).…”

Detection of both Hepatitis A Virus and Norwalk-Like Virus in Imported Clams Associated with Food-Borne Illness

“…This procedure uses a high-pH glycine buffer to elute the virus, polyethylene glycol precipitation to concentrate the virus, Tri-Reagent to extract the RNA, and oligo(dT)-labeled magnetic beads to purify viral RNA in less than 8 h. A modified version of this procedure, combining meats from 12 whole clams for RT-PCR screening, successfully amplified a 275-bp HAV nucleotide sequence (15). Identification of HAV by RT-PCR using RNA extracted from these clams was also reported by the USFDA (8). However, previous attempts by our laboratory to identify NLV, the suspect agent for which these clams were embargoed, were unsuccessful.…”