A polymerase chain reaction to detect a spliced late transcript of human cytomegalovirus in the blood of bone marrow transplant recipients

Direct Quantification of Human Cytomegalovirus Immediate-Early and Late mRNA Levels in Blood of Lung Transplant Recipients by Competitive Nucleic Acid Sequence-Based Amplification

“…Therefore, the merely qualitative IE1 NASBA may not be ideal for monitoring HCMV activity. The high sensitivity and associated lower specificity for predicting symptomatic HCMV infection of qualitative IE1 mRNA monitoring was further indicated in previous studies using reverse transcription-PCR (16,18,20). This was confirmed by a study of Oldenburg evaluating IE1, ␤2.7 (early mRNA), and pp67 gene expression by NASBA in thoracic organ transplant recipients (21).…”

“…Systemic spread of HCMV via productively infected circulating blood leukocytes is a hallmark of disseminating infection, closely linked to development of HCMV disease, and should be limited at an early stage (24). Studies using reverse transcription-PCR for detection of mRNA have indicated that late viral transcripts reflect active HCMV replication in contrast to immediate-early transcripts, which lack specificity for prediction of HCMV disease (11,16,18,20). However, reverse transcription-PCR detecting late mRNA as pp150 (18) and UL18 (14) was only positive in the peak of infection.…”

Human Cytomegalovirus Replicates Abortively in Polymorphonuclear Leukocytes after Transfer from Infected Endothelial Cells via Transient Microfusion Events

“…As previously shown for transfer of viral products from HCMV-infected permissive cells to PMNLs (25), transmission of virus from in vitro-generated HCMV-positive PMNLs to uninfected HELF was similarly prevented or markedly reduced by either lack of contact between the two cell populations or by incubation during coculture with either anti-CD18 (72% reduction of infectious virus) or anti-ICAM-1 (86% reduction) or both monoclonal antibodies (90 to 100% reduction). Anti-E-selectin, anti-ICAM-3, and anti-PECAM-1 monoclonal antibodies only reduced the level of infectious virus transmitted to PMNLs by 10 to 20%.…”

“…Major diagnostic assays using ex vivo PMNL preparations are HCMV viremia, i.e., recovery of infectious virus from PMNLs (15); antigenemia, i.e., detection of HCMV pp65 in the nucleus of PMNLs (11,14,28,34); leukoDNAemia, i.e., detection of viral DNA in PMNLs (13); and leukoRNAemia, i.e., detection of viral mRNAs, either immediate early (IE) (26,35), late (1,2,12,16,17,22,25), or both (23,24), in PMNLs. In addition, the development of diagnostic assays showing the presence of late mRNAs in PMNLs, besides that of IE mRNAs (10,18) and infectious virus (12,15), has strengthened the assumption that HCMV could productively replicate in PMNLs (3,36).…”

Human cytomegalovirus glycoprotein H/glycoprotein L complex modulates fusion-from-without.

“…for 15 min at 4 mC, then dried, the pelleted RNA was resuspended in 10 µl RNAase-free water and digested twice with 1 unit\µl DNase I (Boehringer) for 15 min at room temperature followed by inactivation at 65 mC for 10 min, on the second occasion with the addition of 1 µl 25 mM EDTA (pH 8n0). An aliquot of this sample (2 µl) was reverse transcribed (Nelson et al, 1996) and amplified by PCR using primers specific for the HCMV MIE gene : firstround primers, 5h TGTGTCTGTCAAGTCTGAGC and 5h TTT-CACAGGCGTGACACGTT ; second-round primers, 5h CAGTGTCT-GAGATAGAGGAA and 5h TATTGAGTAGGATTACAGAG (Vinogradskaya et al, 1995). The cycling conditions for both rounds entailed an initial incubation at 94 mC for 5 min followed by 30 cycles of 94 mC for 30 s, 57 mC for 30 s and 72 mC for 90 s then 72 mC for 5 min.…”