A Protocol to Collect Specific Mouse Skeletal Muscles for Metabolomics Studies

Zhang, Gan; Fu, Zhenxing; Stowe, Jennifer; Powell, Frank L.; McCulloch, Andrew D.

doi:10.1007/7651_2015_248

Cited by 3 publications

(9 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Mice were then rapidly killed by cervical dislocation, to minimize metabolic disturbances (Gan et al . ). Plantaris muscles were selected and collected because they have adequate tissue mass and are relatively balanced in fast glycolytic fibres and slow oxidative fibres (Burkholder et al .…”

Section: Methodsmentioning

confidence: 97%

“…In order to minimize the potential effects of the dissection on phosphorylation and metabolic state for assays such as Western blot and immunoprecipitation, the contralateral hindlimb was flash frozen in liquid nitrogen, thawed and dissected on ice as previously described (Gan et al . ). The dissected muscles were stored at −80°C before further processing.…”

Section: Methodsmentioning

confidence: 97%

“…In order to minimize the potential negative effects on other mice, the tube with the mouse for killing was always moved to a separate room at the end of exposure. Mice were then rapidly killed by cervical dislocation, to minimize metabolic disturbances (Gan et al 2016). Plantaris muscles were selected and collected because they have adequate tissue mass and are relatively balanced in fast glycolytic fibres and slow oxidative fibres (Burkholder et al 1994).…”

Section: Hypoxic Exposure and Tissue Collectionmentioning

confidence: 99%

“…The plantaris muscle for RNA extraction was dissected from one hindlimb and stored in RNAlater solution (AM7020 ThermoFisher Scientific, Walthan, MA, USA) at 4°C before further processing. In order to minimize the potential effects of the dissection on phosphorylation and metabolic state for assays such as Western blot and immunoprecipitation, the contralateral hindlimb was flash frozen in liquid nitrogen, thawed and dissected on ice as previously described (Gan et al 2016). The dissected muscles were stored at −80°C before further processing.…”

Section: Hypoxic Exposure and Tissue Collectionmentioning

confidence: 99%

“…AGGGAGGTCGAGCTGTTCTC GGAGTGTTCACTAAGCGGTCA in skeletal muscles were measured as previously described (Gan et al 2016).…”

Section: Genementioning

confidence: 99%

See 4 more Smart Citations

Transcriptomic analysis identifies a role of PI3K–Akt signalling in the responses of skeletal muscle to acute hypoxia in vivo

Zhang

Powell

Zambon

et al. 2017

The Journal of Physiology

Self Cite

View full text Add to dashboard Cite

The effects of acute hypoxia have been widely studied, but there are few studies of transcriptional responses to hours of hypoxia in vivo, especially in hypoxia-tolerant tissues like skeletal muscles. We used RNA-seq to analyse gene expression in plantaris muscles while monitoring respiration, arterial blood gases, and blood glucose in mice exposed to 8% O for 2 or 6 h. Rapid decreases in blood gases and a slower reduction in blood glucose suggest stress, which was accompanied by widespread changes in gene expression. Early down-regulation of genes associated with the extracellular matrix was followed by a shift to genes associated with the nuclear lumen. Most of the early down-regulated genes had mRNA half-lives longer than 2 h, suggesting a role for post-transcriptional regulation. These transcriptional changes were enriched in signalling pathways in which the PI3K-Akt signalling pathway was identified as a hub. Our analyses indicated that gene targets of PI3K-Akt but not HIF were enriched in early transcriptional responses to hypoxia. Among the PI3K-Akt targets, 75% could be explained by a deactivation of adenylate-uridylate-rich element (ARE)-binding protein BRF1, a target of PI3K-Akt. Consistent decreases in the phosphorylation of Akt and BRF1 were experimentally confirmed following 2 h of hypoxia. These results suggest that the PI3K-Akt signalling pathway might play a role in responses induced by acute hypoxia in skeletal muscles, partially through the dephosphorylation of ARE-binding protein BRF1.

show abstract

Section: Methodsmentioning

confidence: 97%

Section: Methodsmentioning

confidence: 97%

Section: Hypoxic Exposure and Tissue Collectionmentioning

confidence: 99%

Section: Hypoxic Exposure and Tissue Collectionmentioning

confidence: 99%

“…AGGGAGGTCGAGCTGTTCTC GGAGTGTTCACTAAGCGGTCA in skeletal muscles were measured as previously described (Gan et al 2016).…”

Section: Genementioning

confidence: 99%

See 3 more Smart Citations

Transcriptomic analysis identifies a role of PI3K–Akt signalling in the responses of skeletal muscle to acute hypoxia in vivo

Zhang

Powell

Zambon

et al. 2017

The Journal of Physiology

Self Cite

View full text Add to dashboard Cite

show abstract

Metabolic Profiling of Multiorgan Samples: Evaluation of MODY5/RCAD Mutant Mice

et al. 2018

View full text Add to dashboard Cite

In the present study, we performed a metabolomics analysis to evaluate a MODY5/RCAD mouse mutant line as a potential model for HNF1B-associated diseases. Gas chromatography time-of-flight mass spectrometry (GC-TOF-MS) of gut, kidney, liver, muscle, pancreas, and plasma samples uncovered the tissue specific metabolite distribution. Orthogonal projections to latent structures discriminant analysis (OPLS-DA) was used to identify the differences between MODY5/RCAD and wild-type mice in each of the tissues. The differences included, for example, increased levels of amino acids in the kidneys and reduced levels of fatty acids in the muscles of the MODY5/RCAD mice. Interestingly, campesterol was found in higher concentrations in the MODY5/RCAD mice, with a four-fold and three-fold increase in kidneys and pancreas, respectively. As expected, the MODY5/RCAD mice displayed signs of impaired renal function in addition to disturbed liver lipid metabolism, with increased lipid and fatty acid accumulation in the liver. From a metabolomics perspective, the MODY5/RCAD model was proven to display a metabolic pattern similar to what would be suspected in HNF1B-associated diseases. These findings were in line with the presumed outcome of the mutation based on the different anatomy and function of the tissues as well as the effect of the mutation on development.

show abstract

An exploration of metabolite and gene responses in mouse skeletal muscles responding to acute sedentary hypoxia

Xue

Huang

Wang

et al. 2021

Preprint

Self Cite

View full text Add to dashboard Cite

Skeletal muscles are involved in responses to acute hypoxia as the largest organ in the body. However, as a hypoxic-tolerant tissue, responses in skeletal muscles caused by acute sedentary hypoxia are much less studied. We measured metabolites in skeletal muscles from mice exposed to 8% O2 for 0 minute, 15 minutes and 2 hours and studied the potential relationship between metabolite levels and mRNA levels by reconstructing genome-based metabolic networks and meta-analyzing differentially expressed genes acquired in skeletal muscles after 2 hours of 8% O2 exposure. The metabolite measurement indicated a significant increase in glutamine metabolism but not lactate metabolism in mouse skeletal muscles after 2 hours of hypoxia, where the metabolic responses as a whole were moderate. The central-dogma based metabolic flux analysis suggested an involvement of glutamine metabolism, though, as a whole, metabolite changes and gene changes didn't show a high correlation. Among metabolites, glutamine metabolism indicated a significant response and a consistent change which could be interpreted by genome-based network analysis. In summary, though this study suggested a moderate metabolic response which has a weak correlation with gene expression change as a whole, glutamine metabolism indicated rapid responses in skeletal muscles responding to acute sedentary hypoxia.

show abstract

A Protocol to Collect Specific Mouse Skeletal Muscles for Metabolomics Studies

Cited by 3 publications

References 19 publications

Transcriptomic analysis identifies a role of PI3K–Akt signalling in the responses of skeletal muscle to acute hypoxia in vivo

Transcriptomic analysis identifies a role of PI3K–Akt signalling in the responses of skeletal muscle to acute hypoxia in vivo

Metabolic Profiling of Multiorgan Samples: Evaluation of MODY5/RCAD Mutant Mice

An exploration of metabolite and gene responses in mouse skeletal muscles responding to acute sedentary hypoxia

Contact Info

Product

Resources

About