A recombinant snake neurotoxin generated by chemical cleavage of a hybrid protein recovers full biological properties

Abstract

We previously reported the production of a fused snake neurotoxin composed of protein A and erabutoxin a in E. coli [1]. The hybrid had much lower toxicity and affinity for the acetylcholine nicotinic receptor than natural erabutoxin. By treating the hybrid with cyanogen bromide we generated a toxin which was purified in a single step by RP-HPLC. This compound, produced in a good yield, recovered all properties of native erabutoxin a, implying that the lower toxic activities of the hybrid were due to the bulky protein A and not to an incorrect folding of the toxin.This work serves as a basis for future studies of toxin-receptor interactions using engineered toxin mutants.

A Recombinant Insect‐Specific α‐Toxin of Buthus occitanus tunetanus Scorpion Confers Protection Against Homologous Mammal Toxins

“…The sense oligonucleotide (5' GGGAGCG-GAGGGTACCCATGGTACGTGACGGTTATATT 3') introduced a KpnI restriction site (underlined), and a methionine residue (bold) at position -1. Since the mature sequence of BotXIV has no methionine residue, it constitutes a unique and useful CNBr-cleavage site, as previously described for other hybrid snake toxins (Ducancel et al, 1989;Boyot et al, 1990;Hodgson et al, 1993;Danse et al, 1994). The antisense oligonucleotide (S'GGGAGCGGCAGGATCCTTATCAGCGATGGCATTTT 3') was designed to introduce a BamHI restriction site and the stop codon TAA (bold), which is efficiently recognized in E. coli.…”

“…IgG-purified fusion protein was cleaved by CNBr treatment as previously described (Boyot et al, 1990). Over 24 h, the major fusion protein (24 kDa) was gradually split into two products: the ZZ domains and a protein of approximately 7 kDa (Fig.…”

“…The procedure followed to cleave the fusion protein by CNBr treatment was that described by Boyot et al (1990). Lyophilized fusion protein was dissolved in 0.1 M HCl in the presence of a 500-fold molar excess of CNBr at room temperature for 24 h. Purification of the resulting recombinant toxin was performed by chromatography on a reverse-phase HPLC column (Vydac, C,) equilibrated in 0.1 % trifluoroacetic acid, followed by trifluoroacetic acid/CH,CN/H,O elution.…”

Three‐dimensional crystal structure of recombinant erabutoxin a at 2.0 Å resolution

“…They block nicotinic acetylcholine receptors from various snake prey with great specificity and high affinity. Their equilibria dissociation constants frequently range between 1 and 20 ' lt3" M. With the view to delineate the site by which these toxins recognize their target, the cDNA encoding erabutoxin a (Ea), a curaremimetic toxin from the venom of the sea-snake, Laticat& semz~asc~atff, was previously cloned [2], expressed as a hybrid protein fused to protein A from ~tffp~ylucoc-cus aureus [3], and the recombinant toxin (Eq) generated in vitro by treating the hybrid in acidic conditions with cyanogen bromide [4]. Despite this drastic treatment, Ea, had identical toxicity in mice, similar affinity for AcChoR from Torpedo rnffrrnor~tff and su~~mposable circular dichroism spectra as compared to Ea from snake venom [4].…”

“…In this paper the 3D structure of Ea, is compared with that of wild-type erabutoxins and especially with that of Eb. cyanogen bromide released the unfused Ea, moiety [4]. The CNBrtreated hybrid was submitted to reverse-phase high pressure liquid chromatography, using a C4 column (Vydac 5~, 25 x 10 mm) equilibrated with TEAF and eluted with a gradient of acetonitrile.…”