A role of the TATA box and the general co-activator hTAFII130/135 in promoter-specific trans-activation by simian virus 40 small t antigen

Abstract

A role of the TATA box and the general co-activator hTAF II The small t antigen (st-ag) of simian virus 40 can exert pleiotropic effects on biological processes such as DNA replication, cell cycle progression and gene expression. One possible mode of achieving these effects is through stimulation of NFkB-responsive genes encoding growth factors, cytokines, transcription factors and cell cycle regulatory proteins. Indeed, a previous study has shown that st-ag enhanced NFkB-mediated transcription. This study demonstrates that promoters possessing a consensus TATA box (i.e. TATAAAAG) in the context of either NFkB-or Sp1-binding sites are trans-activated by st-ag. Overexpressing the general transcription factor hTAF II 130/135, but not hTAF II 28 or hTAF II 80, stimulated the activity of promoters in a consensus TATA box-dependent mode. Converting the consensus TATA motif into a non-consensus TATA box strongly impaired activation by st-ag and hTAF II 130/135. Conversely, mutating a non-consensus TATA motif into the consensus TATA box rendered the mutated promoter inducible by st-ag and hTAF II 130/135. Mutation of the TATA box had no effect on TNFa-or RelA/p65-mediated induction of NFkB-responsive promoters, indicating a specific st-ag effect on hTAF II 130/135. St-ag stimulated the intrinsic transcriptional activity of hTAF II 130/135. Substitutions in the conserved HPDKGG motif in the N-terminal region or a mutation that impaired the interaction with protein phosphatase 2A abrogated the ability of st-ag to activate hTAF II 130/135-mediated transcription. These results indicate that trans-activation of promoters by st-ag may depend on a consensus TATA motif and suggest that such promoters recruit the general transcription factor hTAF II 130/135.

Yeast TFIID Serves as a Coactivator for Rap1p by Direct Protein-Protein Interaction

“…Indeed, to date, transfactor-Taf4p interactions are arguably the most frequently observed interactions between DNA binding transfactors and TFIID. Factors Sp1, CREB, RAR, HP1, CBF, RanBPM, simian virus 40 small t antigen, NFAT, AhR, and c-Jun have all been reported to interact with Taf4p (1,6,7,13,18,19,28,32,34,54,68,71,89,94). Given these numerous Taf4p-Taf12p-transfactor interactions, it will be interesting to dissect the molecular details of Rap1p-Tafp binding.…”

“…Woontner whole-cell extracts (WCEs) (95) were prepared, antibody depleted, and assayed by primer extension as described previously (35,72,79). mRNA HIS3 transcribed from the UAS RAP1 -HIS3 reporter was scored using 32 P-labeled primer ATCGC AATCTGAATCTTGGTTTCATTTGTAATACGC (specific activity, ϳ6,700 cpm/fmol; 25 fmol primer/reaction); extension produced a cDNA of 107 nucleotides. Extension products were detected with X-ray film and quantitated via imaging (Kodak K-screen; Bio-Rad Molecular Imager FX and Bio-Rad QuantityOne software) and corrected for recovery by quantitation of a 32 P-labeled 330-nucleotide internal recovery control DNA added to each reaction mixture with the transcription stop mix.…”

Signaling and Transcriptional Changes Critical for Transformation of Human Cells by Simian Virus 40 Small Tumor Antigen or Protein Phosphatase 2A B56γ Knockdown

“…Many of these expression changes likely result from previously identified effects of SV40 ST in signal transduction pathways such as p27/Kip1 down-regulation (30), AKT and telomerase activation (51), mitogen-activated protein kinase pathway activation (52), protein kinase C activation of NFB (37,53), and induction of cyclins (46,47). The remainder of the expression alterations may result from still unidentified effects of ST on other signal transduction pathways or from direct effects of ST on transcription factors.…”

Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus Up-Regulates Transcription of Human Telomerase Reverse Transcriptase Promoter through Interaction with Transcription Factor Sp1

“…Other viral proteins have also been shown to modulate Sp1-mediated transcriptional activation. The simian virus 40 small antigen has been shown to stimulate Sp1-dependent transcription mediated by protein kinase C and its upstream regulator phosphatidylinositol 3-kinase and dependent on a consensus TATA motif (27,38,74). The E1A protein encoded by adenovirus can also induce the p21 promoter activity mediated by Sp1 binding sites, most probably by interacting with the CR3 region of E1A, which has been shown to be the binding site for other transcriptional activators, including c-Jun, ATF-1, -2, and -3, CBF, TBP, TAF (II) 110, 135, and 250, and YY1 (23,64).…”