A search for cyclophilin‐A gene (PPIA) variation and its contribution to the risk of atherosclerosis and myocardial infarction

Abstract

Cyclophilin A is secreted by vascular smooth muscle cells in response to inflammatory stimuli, and could thus contribute to atherosclerosis. We hypothesized that the genetic variation at the cyclophilin A gene (PPIA) could affect the risk for developing atherosclerosis and myocardial infarction. This study included 250 myocardial infarction patients (all male and < 60 years; 95% are smokers). All these cases had at least one atherosclerotic diseased coronary vessel. DNA was obtained from patients and from 250 healthy controls. The variation at the PPIA gene was determined in the patients through single-strand conformation analysis and direct sequencing of seven polymerase chain reaction fragments. Allele and genotype frequencies were compared between patients and controls. The effect of a promoter polymorphism (-11 G/C) on gene expression was in vitro analysed with luciferase-reporter assays. We found two common polymorphisms in the PPIA promoter (-11 G/C) and the 5' non-translated (+36 G/A) regions. Cells transfected with luciferase-plasmids containing the -11 G had significantly higher luciferase activity. Genotype frequencies for these polymorphisms did not differ between patients and controls. In conclusion, we reported a functional variant in the PPIA promoter. However, the PPIA variation did not significantly contribute to the risk of suffering from myocardial infarction among patients with atherosclerotic diseased vessels.

Polymorphisms in the Regulatory Region of the Cyclophilin A Gene Influence the Susceptibility for HIV-1 Infection

“…Polymorphisms in the promoter region of CypA may have an effect on the CyPA expression levels and recently it was demonstrated that the 1604G allele enhances binding of transcription factors such as SP1, resulting in increased transcription of the CypA gene [25], [30]. Seemingly in contrast, we here observed a reduction in CypA expression in PBMC isolated from healthy C1604G heterozygous blood donors when compared to PBMC from carriers of the major allele.…”

A search for cyclophilin‐A gene variants in cyclosporine A‐treated renal transplanted patients

“…The −11 G could mediate its pro‐nephrotoxic effect through an increased production of cyclophilin A. To confirm this hypothesis, we transfected HEK293 cells with luciferase plasmids containing the two promoters (−11 G and −11 C), and found higher promoter activity for cells transfected with −11 G. We had previously reported this functional effect in a different cell‐type (16). The −11 G has been linked to a more rapid CD4+ T‐cell loss and a more rapid progression to AIDS, compared to −11 C (CypA is incorporated into HIV‐1 virions and facilitates HIV‐1 replication in host cells) (29).…”

“…Transient transfection and reporter assays were performed to compare the activity of different alleles of PPIA promoter in driving expression, as previously reported (16). Both PPIA promoters from −578 to +69 bp relative to the transcriptional start site (ENSG00000196262) were generated by PCR using genomic DNA from an heterozygous patient (−11 G/C) and the following primers, containing Kpn I and Hind III restriction sites, respectively: forward, GCTCAAAGGTACCCTCCTTCCTGAC and reverse GACGGCAAGCTTGAAGAACACGG.…”

Cyclophilin A as a target in the treatment of cytomegalovirus infections

“… 121 – 129 This protein can stimulate the immune response and is produced by inflammatory cells such as endothelial cells, monocytes, vascular smooth muscle cells, and platelets. 130 – 132 Extracellular CyPA, through interaction with cell membrane heparin receptor and CD147, also functions as a chemoattractant for monocytes, neutrophils, eosinophils, and T lymphocytes. 133 Like other CyPs, CyPA acts as a chaperone in the regulation of cellular protein 111 , 120 , 125 and receptor expression and activities.…”