A Sensitive Assay for Virus Discovery in Respiratory Clinical Samples

Abstract

In 5–40% of respiratory infections in children, the diagnostics remain negative, suggesting that the patients might be infected with a yet unknown pathogen. Virus discovery cDNA-AFLP (VIDISCA) is a virus discovery method based on recognition of restriction enzyme cleavage sites, ligation of adaptors and subsequent amplification by PCR. However, direct discovery of unknown pathogens in nasopharyngeal swabs is difficult due to the high concentration of ribosomal RNA (rRNA) that acts as competitor. In the current study we optimized VIDISCA by adjusting the reverse transcription enzymes and decreasing rRNA amplification in the reverse transcription, using hexamer oligonucleotides that do not anneal to rRNA. Residual cDNA synthesis on rRNA templates was further reduced with oligonucleotides that anneal to rRNA but can not be extended due to 3′-dideoxy-C6-modification. With these modifications >90% reduction of rRNA amplification was established. Further improvement of the VIDISCA sensitivity was obtained by high throughput sequencing (VIDISCA-454). Eighteen nasopharyngeal swabs were analysed, all containing known respiratory viruses. We could identify the proper virus in the majority of samples tested (11/18). The median load in the VIDISCA-454 positive samples was 7.2 E5 viral genome copies/ml (ranging from 1.4 E3–7.7 E6). Our results show that optimization of VIDISCA and subsequent high-throughput-sequencing enhances sensitivity drastically and provides the opportunity to perform virus discovery directly in patient material.

A major outbreak of conjunctivitis caused by coxsackievirus A24, Réunion, January to April 2015

“…Nucleic acid extraction was then performed with a NucliSens easyMAG magnetic bead system (BioMérieux). cDNA synthesis was performed as described before [17] with some modifications. Reverse transcription was performed with 50 ng of random hexamers (New England Biolabs) and 200 U of SuperScript III reverse transcriptase enzyme (Life Technologies) followed by RNA digestion with 2 U of RNase H (Life Technologies).…”

Altered exhaled biomarker profiles in children during and after rhinovirus-induced wheeze

“…All naso-and oropharyngeal swabs (Copan, Brescia, Italy) were tested within 6 h of collection for the presence of 14 respiratory viruses by multiplex quantitative PCR (rhinovirus, respiratory syncytial virus, influenza viruses A and B, enterovirus, metapneumovirus, coronavirus, parechovirus, parainfluenza viruses 1-4, bocavirus, and adenovirus) [23]. A virus was deemed present when either the naso-or oropharyngeal swab tested positive.…”

A novel genus in the order Picornavirales detected in human stool

“…Reverse transcription was performed with MMLV-Reverse Transcriptase, as described by de Vries et al (2011). Real-time PCR was performed using the standard protocol for a Rotor-Gene Probe RT-PCR kit (Qiagen) with GCCACTTCAGAGCGAT-ACAA and AGAAGTTCCCAAACCCACAT as primers and 59FAM-AGGGCGTGCAAGTAGATCAGACACA-TAMRA39 as the probe.…”