A Serine Protease Homolog Negatively Regulates TEP1 Consumption in Systemic Infections of the Malaria Vector Anopheles gambiae

Abstract

Clip domain serine protease homologs are widely distributed in insect genomes and play important roles in regulating insect immune responses, yet their exact functions remain poorly understood. Here, we show that CLIPA2, a clip domain serine protease homolog of Anopheles gambiae, regulates the consumption of the mosquito complement-like protein TEP1 during systemic bacterial infections. We provide evidence that CLIPA2 localizes to microbial surfaces in a TEP1-dependent manner whereby it negatively regulates the activity of a putative TEP1 convertase, which converts the full-length TEP1-F form into active TEP1_cut. CLIPA2 silencing triggers an exacerbated TEP1-mediated response that significantly enhances mosquito resistance to infections with a broad class of microorganisms including Plasmodium berghei, Escherichia coli and the entomopathogenic fungus Beauveria bassiana. We also provide further evidence for the existence of a functional link between TEP1 and activation of hemolymph prophenoloxidase during systemic infections. Interestingly, the enhanced TEP1-mediated immune response in CLIPA2 knockdown mosquitoes correlated with a significant reduction in fecundity, corroborating the existence of a trade-off between immunity and reproduction. In sum, CLIPA2 is an integral regulatory component of the mosquito complement-like pathway which functions to prevent an overwhelming response by the host in response to systemic infections.

Functional Interaction between Apolipophorins and Complement Regulate the Mosquito Immune Response to Systemic Infections

“…Double-stranded RNAs (dsRNA) for LacZ (control), TEP1, CLIPA2 , Apo-II/I , Apo-III and Jun were synthesized using the T7-primers previously described [1,8,10,13,15], respectively. DsRNA for fondue was produced using the following pairs of T7-tagged primers (T7-tag underlined): T7-fondue-F, 5′- TAATACGACTCACTATAGGG TGCCAGCTCTTCGCACAACAGT-3′ and T7-fondue-R, 5′- TAATACGACTCACTATAGGG GCATATTGAACGTCTTGGG TT-3′.…”

“…Concerning the bacterial proliferation assay, the different mosquito genotypes were injected with 69 nl of E. coli (OP-50 strain) or S. aureus suspension in PBS at an OD 600 nm of 0.4. Bacterial CFU counts were performed exactly as previously described [13]. Experiments were repeated two to three times and statistical significance was calculated using the Mann-Whitney test.…”

“…Proteins were resolved by nonreducing SDS-PAGE and transferred to immunoblot PVDF membrane using wet transfer (Bio-Rad). Blots were incubated with mouse αCLIPA2 [13], rabbit αTEP1 [18], mouse αApo-II [15] and rabbit αPPO6 [19] polyclonal antibodies at dilutions 1/1,000, 1/1,000, 1/100 and 1/2,000, respectively. Anti-mouse and anti-rabbit IgG-horseradish peroxidase-conjugated secondary antibodies (Promega) were used at 1/6,000 and 1/12,000, respectively.…”

“…Following activation, TEP1 accumulation on microbial surfaces is also controlled by two noncatalytic clip domain serine proteases (CLIPs), SPCLIP1 and CLIPA2, which act as positive and negative regulators of that process, respectively, suggesting the presence of a convertase-like activity analogous to that in mammalian complement. Silencing LRIM1 in naive mosquitoes triggered the loss of TEP1 cut [9,10], SPCLIP1 [12] and CLIPA2 [13] from the hemolymph, demonstrating the tight association of these CLIPs with TEP1 activity.…”

Nobel Parasites in the Kingdom of Invertebrates

“…Considering the global disease burden associated with malaria, it is no surprise that it has attracted the attention of many researchers. Notably, malaria and innate immunity are tightly interwoven and thus the Journal of Innate Immunity has also published a number of articles within the last years that deal with virulence mechanisms employed by this pathogen [3,4,5]. …”