A Simple and Rapid Method for Isolation of High Quality Genomic DNA from Fruit Trees and Conifers Using PVP

Abstract

Because DNA degradation is mediated by secondary plant products such as phenolic terpenoids, the isolation of high quality DNA from plants containing a high content of polyphenolics has been a difficult problem. We demonstrate an easy extraction process by modifying several existing ones. Using this process we have found it possible to isolate DNAs from four fruit trees, grape (Vitis spp.), apple (Malus spp.), pear (Pyrus spp.) and persimmon (Diospyros spp.) and four species of conifer, Pinus densiflora, Pinus koraiensis,Taxus cuspidata and Juniperus chinensis within a few hours. Compared with the existing method, we have isolated high quality intact DNAs (260/280 = 1.8-2.0) routinely yielding 250-500 ng/microl (total 7.5-15 microg DNA from four to five tissue discs).

A novel and efficient protocol for the isolation of genomic DNA from<br>mulberry (Morus L.)

“…Similarly, PVP forms complex compounds by hydrogen bonding with phenolic compounds and co-precipitates along with cell debris thus preventing polyphenols from interacting with DNA. When the extract is centrifuged in the presence of chloroform, the PVP complexes accumulate at the interface between the organic and the aqueous phases (Kim et al, 1997;Barwell et al, 1998). CTAB is a cationic detergent, which solubilizes membranes and also binds to fructans and other polysaccharides to form complexes that are removed during subsequent chloroform extraction.…”

Genotyping of Plant and Animal Samples without Prior DNA Purification

“…For particularly challenging plants with high phenolic content, addition of polyvinylpyrrolidone was traditionally used to remove the compounds that bind to DNA following cell lysis 2,5 . As evident here, these complicated, time-intensive steps can be avoided through use of the Phire Plant Direct PCR Kit to detect the target DNA.…”

“…PCR from plant tissues traditionally involves an initial DNA isolation step, which may require expensive or toxic reagents. The process is time consuming and increases the risk of cross contamination 1,2 . Conversely, by using Thermo Scientific Phire Plant Direct PCR Kit the target DNA can be easily detected, without prior DNA extraction.…”

“…In these cases, an additional step to remove the compounds is traditionally required 2,5 . Here, this problem is overcome by using a quick and easy dilution protocol followed by Direct PCR amplification (Figure 1).…”

Isolation and Computational Characterization of Glutathione Peroxidase Gene from an Aquatic Fern - <i>Salvinia molesta </i>

“…Plants were collected from different areas as described in Ganguli et.al [4] and DNA was extracted using the CTAB method [5,6] and genomic PCR was performed using genomic DNA. The gene was amplified using forward and reverse primers GCATAATCATATGACTGCCC and, AGAAAATTACAACAAATTCT respectively.…”