A small animal peripheral challenge model of yellow fever using interferon-receptor deficient mice and the 17D-204 vaccine strain

Thibodeaux, Brett A.; Garbino, Nina C.; Liss, Nathan M.; Piper, Joseph; Blair, Carol D.; Roehrig, John T.

doi:10.1016/j.vaccine.2012.03.003

Cited by 39 publications

(61 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The viral RNA gradually accumulated starting with day 3 and peaked on days 12–15 after infection. In agreement with the previous study (Thibodeaux et al, 2012), infected animals at this time point showed clinical signs of neurotropic disease (paresis, high limb paralysis) and met euthanasia criteria shorty after this time point. Replication kinetics of YF 17D and pYF17D-16 iDNA-derived virus in the liver tissues differed from those in the brain.…”

Section: Resultssupporting

confidence: 92%

“…Based on this observation, s.c. infection of IFN-α/β deficient mice is currently considered to be a biologically relevant model of wild-type YFV infection (Meier et al, 2009). Mice deficient for receptors for both types of IFN, α/β and γ (AG129) are also susceptible to YF 17D in a dose-dependent manner (Thibodeaux et al, 2012). YF 17D virus does not persist in AG129 mice.…”

Section: Resultsmentioning

confidence: 99%

“…Tissue samples were collected and stored at liquid nitrogen before RNA purification. Quantitative RT/PCR with the 8280f primer, CCACTCATGAAATGTACTACGTGTCTG; 8354r primer, GGAGGCGGGATGTTTGGT, and fluorogenic 8308pr probe, AGCCCGCAGCAATGTCACATTTACTGT, was performed as previously described (Thibodeaux et al, 2012) and viral genome copies were calculated and expressed as viral genome equivalents per 100 mg of tissues. At day 0, 6, and 15 two additional mice from each group were euthanized, samples of liver, brain, kidney, and spleen were removed, fixed in 10% formalin, then samples were prepared for paraffin-embedding, sectioning and hematoxylin and eosin (H&E) staining.…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice

et al. 2014

View full text Add to dashboard Cite

Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20µg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF.

show abstract

Section: Resultssupporting

confidence: 92%

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice

et al. 2014

View full text Add to dashboard Cite

show abstract

“…Interestingly, even in the absence of B and T cells (Rag1 KO), primary i.v. infection with YF-17D was still sub-clinical, which given the apparently cytolytic nature and replicative capacity of YF-17D virus, strongly support the idea that virus control and clearance following peripheral infection/vaccination can be accomplished entirely by innate host mechanisms (23,24). …”

Section: Resultsmentioning

confidence: 54%

“…administration of YF-17D virus. The relevance of this challenge model compared to natural infection has been debated, and mice lacking both type I and type II IFN signaling pathways have been claimed to represent a better model for human YF infection due to their susceptibility to peripheral challenge with the 17D virus (23,24). This may hold true if one aims to use YF-17D as a paradigm for wt YF virus, but this model is obviously not suitable for analysis of the vaccine-induced immunity, since no protective response can be mounted in those animals.…”

Section: Discussionmentioning

confidence: 99%

CD8+ T Cells Complement Antibodies in Protecting against Yellow Fever Virus

Bassi

Kongsgaard

Steffensen

et al. 2015

The Journal of Immunology

View full text Add to dashboard Cite

The attenuated yellow fever vaccine (YF-17D) was developed in the 1930’s, yet little is known about the protective mechanisms underlying its efficiency. In this study, we analyzed the relative contribution of cell-mediated and humoral immunity to the vaccine-induced protection in a murine model of YF-17D infection. Using different strains of knock-out mice, we found that CD4+ T cells, B cells and antibodies are required for full clinical protection of vaccinated mice, while CD8+ T cells are dispensable for long-term survival following intracerebral (i.c.) challenge. However, by analysing the immune response inside the infected CNS, we observed an accelerated T-cell influx into the brain following i.c. challenge of vaccinated mice, and this T-cell recruitment correlated with improved virus control in the brain. Using mice deficient in B cells we found that, in the absence of antibodies, YF vaccination can still induce some antiviral protection, and in vivo depletion of CD8+ T cells from these animals revealed a pivotal role for CD8+ T cells in controlling virus replication in the absence of a humoral response. Finally, we demonstrated that effector CD8+ T cells also contribute to viral control in the presence of circulating YF-specific antibodies. To our knowledge this is the first time that YF-specific CD8+ T cells have been demonstrated to possess antiviral activity in vivo.

show abstract

Experimental DNA-Launched Live-Attenuated Vaccines Against Infections Caused by Flavi- and Alphaviruses

Pushko

Bredenbeek

Lukashevich

2014

Novel Technologies for Vaccine Development

View full text Add to dashboard Cite

A small animal peripheral challenge model of yellow fever using interferon-receptor deficient mice and the 17D-204 vaccine strain

Cited by 39 publications

References 27 publications

Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice

Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice

CD8+ T Cells Complement Antibodies in Protecting against Yellow Fever Virus

Experimental DNA-Launched Live-Attenuated Vaccines Against Infections Caused by Flavi- and Alphaviruses

Contact Info

Product

Resources

About