A Suitable Streptomycin-Resistant Mutant for Constructing Unmarked In-Frame Gene Deletions Using rpsL as a Counter-Selection Marker

Abstract

The streptomycin counter-selection system is a useful tool for constructing unmarked in-frame gene deletions, which is a fundamental approach to study bacteria and their pathogenicity at the molecular level. A prerequisite for this system is acquiring a streptomycin-resistant strain due to rpsL mutations, which encodes the ribosomal protein S12. However, in this study no streptomycin resistance was found to be caused by rpsL mutations in all 127 clinical strains of Klebsiella pneumoniae isolated from liver abscess patients. By screening 107 spontaneous mutants of streptomycin resistance from a clinical strain of K. pneumoniae, nucleotide substitution or insertion located within the rpsL was detected in each of these strains. Thirteen different mutants with varied S12 proteins were obtained, including nine streptomycin-dependent mutants. The virulence of all four streptomycin-resistant mutants was further evaluated. Compared with the parental strain, the K42N, K42T and K87R mutants showed a reduction in growth rate, and the K42N and K42T mutants became susceptible to normal human serum. In the mice LD50 (the bacterial dose that caused 50% death) assay, the K42N and K42T mutants were ∼1,000-fold less lethal (∼2×105 CFU) and the K87R mutant was ∼50-fold less lethal (∼1×104 CFU) than the parental strain (∼2×102 CFU). A K42R mutant showed non-observable effects on the above assays, while this mutant exhibited a small cost (P<0.01) in an in vitro growth competition experiment. In summary, most of the K. pneumoniae strains with streptomycin resistance caused by rpsL mutations are less virulent than their parental strain in the absence of streptomycin. The K42R mutant showed similar pathogenicity to its parental strain and should be one of the best choices when using rpsL as a counter-selection marker.

Survey on antimicrobial resistance patterns in Vibrio vulnificus and Vibrio cholerae non-O1/non-O139 in Germany reveals carbapenemase-producing Vibrio cholerae in coastal waters

“…Resistance to streptomycin is often mediated by enzymatic inactivation through adenylation by aminoglycoside (3″) adenyltransferases ( aadA genes) or through phosphorylation by aminoglycoside phosphotransferases ( strA / strB genes; Shaw et al, 1993 ; Tsai et al, 2014 ). However, none of the Vibrio isolates was positive for amplification of aadA1, aadA2 , or strA/B genes that are commonly found in Enterobacteriaceae and that have already been identified in V. cholerae (Hochhut et al, 2001 ; Sá et al, 2010 ; Yu et al, 2012 ).…”

“…However, none of the Vibrio isolates was positive for amplification of aadA1, aadA2 , or strA/B genes that are commonly found in Enterobacteriaceae and that have already been identified in V. cholerae (Hochhut et al, 2001 ; Sá et al, 2010 ; Yu et al, 2012 ). Ribosomal alterations resulting from mutations in the rpsL gene encoding ribosomal protein S12 can be another cause of streptomycin resistance (Shaw et al, 1993 ; Tsai et al, 2014 ). However, amino acid sequences of ribosomal protein S12 were identical in all investigated strains, irrespective of the streptomycin resistance phenotype.…”

“…Observed single nucleotide polymorphisms within the rpsL gene of some resistant as well as of some susceptible isolates were silent mutations. This indicates that other streptomycin inactivating enzymes or other resistance mechanisms, such as decreased permeability or other ribosomal alterations (e.g., mutations in the rrs gene encoding the 16S ribosomal RNA) may be responsible for the observed phenotype (Shaw et al, 1993 ; Tsai et al, 2014 ).…”

Roles of ramR and tet (A) Mutations in Conferring Tigecycline Resistance in Carbapenem-Resistant Klebsiella pneumoniae Clinical Isolates

“…For homologous recombination, pramR-Del was transformed into E. coli S17-1 pir using the heat shock method and was then mobilized into NVT2001 via conjugation. The transconjugants were screened on brilliant green plates containing inositol-nitrate-deoxycholate (BIND) supplemented with kanamycin (50 g/ml) to select K. pneumoniae strains harboring pramR-Del, while the growth of non-K. pneumoniae contaminants was effectively suppressed on the BIND plates (33). The selected K. pneumoniae strains were incubated for 6 h in 20 ml of BHI medium in the absence of kanamycin, and then the inocula were spread onto LB medium plates containing 10% sucrose.…”

An Animal Model to StudyKlebsiella pneumoniaeGastro-Intestinal Colonization and Host-to-Host Transmission

“…Sequence polymorphism in the wzi gene has been used to identify and characterize different isolates. Kpn AZ10 ( wzi 372) an antibiotic sensitive isolate was made str-resistant as described, subsequently mouse GI passaged and named AZ99 (28, 29). To construct the fimH mutant in the appropriate genetic background, PCR was carried out using Q5 polymerase (NEB) with AZ101 genomic DNA as template, and primers fimH upstream (GGCGGTGATTAACGTCACCT) and fimH downstream (GATAGAGCAGCGTTTGCCAC), which give at least 500bp homology on either end of the transposon cassette.…”