A transcriptional enhancer with specificity for erythroid cells is located in the long terminal repeat of the Friend murine leukemia virus.

Bösze, Zsuzsanna; Thiesen, Hans‐Jürgen; Charnay, Patrick

doi:10.1002/j.1460-2075.1986.tb04404.x

Cited by 53 publications

(33 citation statements)

References 58 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Figure 4A and B). It starts at a sequence TTCTGGCCAGGCCCCTGTCGGGGTCAG that is highly homologous to sequences also found in the enhancer region of the long terminal repeat of Friend murine leukaemia virus and Moloney leukaemia virus (Bosze et al, 1986). The ubiquitous part of the footprint covers the 3' half of this sequence and ends downstream at a CAC-box sequence ( Figure 4C, marked GT) and mobility shift/ competition experiments show that this region binds a number of proteins (not shown), including Spl (Gidoni et al, 1985).…”

Section: Resultsmentioning

confidence: 92%

“…This hypersensitive region is only observed in erythroid cells in vivo, although part of it is observed after transfection/selection in non-erythroid cells (Blom van Assendelft et al, 1989;Forrester et al, 1989). The nonerythroid specific sensitivity correlates with a region containing a sequence also found in the enhancer present in the long terminal repeat of Moloney-type retroviruses, including the erythroid specific Friend virus (Bosze et al, 1986 (Gilmour et al, 1984;Berg et al, 1989). The strongly activating region is primarily characterized by a dimer NF-E1 site and a dimer jun/fos Fig.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Detailed analysis of the site 3 region of the human beta-globin dominant control region.

Talbot¹,

Philipsen²,

Fraser³

et al. 1990

The EMBO Journal

324

295

View full text Add to dashboard Cite

Four DNase I hypersensitive sites characterize the human beta‐globin Dominant Control Region (DCR) providing position independent, high levels of erythroid specific expression to linked homologous and heterologous genes when introduced into cultured cells or in transgenic mice. We have delineated the hypersensitive site located 10.5 kbp upstream of the epsilon‐globin gene by short range DNase I sensitivity mapping to a 600 bp region. Using transgenic mice and MEL cells the functional part of this region was further mapped to a 300 bp central core, which provides position independent, high level expression. It contains a number of ubiquitous and erythroid specific protein binding sites, including the previously described factors NF‐E1 (GF1) and NF‐E2. The latter binds to a dimer of the consensus binding sequence for jun/fos. The presence of this sequence is required for the function of the element, but single or multimerized copies of this site failed to give position independent, high levels of expression in transgenic mice or MEL cells. We therefore conclude that a combination of factor binding sites is necessary to allow site 3 to function as a strong transcriptional activator, resulting in position independent expression of the beta‐globin gene.

show abstract

Section: Resultsmentioning

confidence: 92%

Section: Discussionmentioning

confidence: 99%

Detailed analysis of the site 3 region of the human beta-globin dominant control region.

Talbot¹,

Philipsen²,

Fraser³

et al. 1990

The EMBO Journal

324

295

View full text Add to dashboard Cite

show abstract

“…The samples were fractionated on 12% polyacrylamide-50% urea denaturing gels (24 tions within the promoter, it was necessary to increase the amount of RNA initiating from the mouse ,-globin promoter. For this purpose, a fragment from the Friend virus LTR containing a putative enhancer element (6) known to be active in erythroid cells (2) was cloned into the deletion mutant constructs at the 3' end of the MT gene to give the plasmids pPMT41200F, pp3MTA300F, and p,MTF (p,MTF, the A106 construct, is shown in Fig. 2A).…”

mentioning

confidence: 99%

DNA sequences involved in transcriptional regulation of the mouse beta-globin promoter in murine erythroleukemia cells.

Cowie¹,

Myers²

1988

Mol. Cell. Biol.

View full text Add to dashboard Cite

We have developed a transient assay in murine erythroleukemia (MEL) cells to analyze the cis-acting sequence requirements for transcriptional regulation of the mouse P-major-globin promoter. From deletion analysis, a fragment of the promoter region, from -106 to +26 relative to the RNA cap site, was found to be sufficient for regulated transcription in MEL cells following induction of differentiation by dimethyl sulfoxide. Single-base mutational analysis of this 132-base-pair promoter fragment identified three sequence elements required for transcription in MEL cells. These are the ATATAA sequence at -31 to -26, the CCAATC sequence between -77 and -72, and the GCCACACCC sequence between -95 and -87. In addition, we found a requirement for sequences adjacent to the CCAAT and ATATAA consensus motifs. Point mutations within the promoter did not abolish transcriptional regulation following induction of differentiation by dimethyl sulfoxide. However, mutations that resulted in reduced transcription levels in uninduced MEL cells gave similarly decreased levels in induced MEL cells.The adult ,-globin genes exhibit tissue-specific and developmentally specific regulation, being expressed only in adult erythroid cells in the final stages of differentiation. A prerequisite towards understanding the mechanisms of ,-globin expression is the identification of cis-acting DNA sequences involved in the regulation of transcription of the gene in erythroid cells. Murine erythroleukemia (MEL) cells offer a number of advantages as a model system for the study of adult globin regulation. These established cell lines, derived from adult hematopoietic precursor cells transformed with the Friend virus complex (14), are easily propagated in culture and will undergo terminal differentiation in response to a number of different inducing agents such as dimethyl sulfoxide (DMSO), hexamethylenebisacetamide (HMBA), and hemin, closely mimicking normal events of hematopoiesis (for a review, see reference 25). Among the many morphological and biochemical changes that occur during this induced differentiation of MEL cells is a 10-to 50-fold increase in the level of P-globin RNA. When cloned mouse, rabbit, or human P-globin genes are introduced into MEL cells by DNA-mediated gene transfer, they are regulated in a manner similar to that of the endogenous globin genes (3, 28, 39, 40). This increase in the amount of ,3-globin RNA is due in part to an increase in the rate of transcription (20, 40) and in part to an increase in RNA stability (37).Studies of hybrid mouse and human 3-globin genes have suggested the existence of multiple control elements within and adjacent to the gene involved in this increase in RNA synthesis following induction of differentiation. It was demonstrated for mouse and human 3-globin that sequences 5' to the gene, including the promoter and upstream region, and sequences 3' to the initiation codon, including the coding region and 3'-flanking sequences, were independently able to bring about the increase in specific RNA in...

show abstract

“…The vector pFr-SV(X) differs from pZIP-SV(X) in that it contains a 380-nucleotide substitution in the LTR. These 380 nucleotides contain determinants identified as putative enhancer sequences (27,28) and were substituted for those of MoMuLV in the vector pZIP-SV(X) (13). The substituted 380 nucleotides have been shown to convert replication-competent Mo-MuLV from a virus that caused predominantly T-cell lymphomas in NFS mice to one that caused erythroleukemia (10,28).…”

Section: Resultsmentioning

confidence: 99%

Enhancer sequences of a retroviral vector determine expression of a gene in multipotent hematopoietic progenitors and committed erythroid cells.

Holland

Anklesaria²,

Sakakeeny³

et al. 1987

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

To analyze the transcriptional activity of retroviral enhancer sequences in hematopoietic lineages, we determined the effect of enhancer sequences on the expression of the neomycin resistance gene transferred by two retroviral vectors to primary hematopoietic lineages. We constructed the vector pFr-SV(X). The Moloney murine leukemia virus enhancer region of a vector, pZIP-SV(X), was replaced by a 380-nucleotide-long fragment containing the enhancer sequences of the Friend murine leukemia virus. The enhancer sequences of Friend murine leukemia virus were used because these sequences have been shown to target the disease speci-

show abstract

A transcriptional enhancer with specificity for erythroid cells is located in the long terminal repeat of the Friend murine leukemia virus.

Cited by 53 publications

References 58 publications

Detailed analysis of the site 3 region of the human beta-globin dominant control region.

Detailed analysis of the site 3 region of the human beta-globin dominant control region.

DNA sequences involved in transcriptional regulation of the mouse beta-globin promoter in murine erythroleukemia cells.

Enhancer sequences of a retroviral vector determine expression of a gene in multipotent hematopoietic progenitors and committed erythroid cells.

Contact Info

Product

Resources

About