A transgenic resource for conditional competitive inhibition of conserved Drosophila microRNAs

Abstract

Although the impact of microRNAs (miRNAs) in development and disease is well established, understanding the function of individual miRNAs remains challenging. Development of competitive inhibitor molecules such as miRNA sponges has allowed the community to address individual miRNA function in vivo. However, the application of these loss-of-function strategies has been limited. Here we offer a comprehensive library of 141 conditional miRNA sponges targeting well-conserved miRNAs in Drosophila. Ubiquitous miRNA sponge delivery and consequent systemic miRNA inhibition uncovers a relatively small number of miRNA families underlying viability and gross morphogenesis, with false discovery rates in the 4–8% range. In contrast, tissue-specific silencing of muscle-enriched miRNAs reveals a surprisingly large number of novel miRNA contributions to the maintenance of adult indirect flight muscle structure and function. A strong correlation between miRNA abundance and physiological relevance is not observed, underscoring the importance of unbiased screens when assessing the contributions of miRNAs to complex biological processes.

mir-276a strengthens Drosophila circadian rhythms by regulating timeless expression

“…Similar results were obtained by decreasing mir-276a levels only in adults with a mir-276a sponge expressed under Pdf-geneswitch control, further indicating that flies are also less rhythmic when mir-276a levels decrease in adult PDFcontaining neurons (Fig. 1C) (22). In conclusion, manipulating mir276a levels up or down in circadian neurons reduces rhythmicity.…”

microRNAs That Promote or Inhibit Memory Formation in Drosophila melanogaster

“…For the first screen, we crossed elav c155 -gal4 virgin females in a w CS10 genetic background with either uas-scramble-miR-SP or uas-miR-SP males in a w 1118 genetic background (Loya et al 2009;Fulga et al 2015). The sponge constructs and derivative fly lines are described in Fulga et al (2015). The same uas-scramble-miR-SP (TTAGAATTTAAACCTCACCATGA) control (either attP2 or attP40 insertion) was used with all miR-SP lines.…”

“…Multiple brain regions and neuron types have been shown to be involved in olfactory learning, including projection neurons (PNs) of the antennal lobe, mushroom body neurons (MBn), the dorsal paired medial neurons (DPMn), dopaminergic neurons (DAn), and others (Davis 2005(Davis , 2011Busto et al 2010). Thus, the rapid regulation of gene expression by miRNA function is predicted to occur in one or more areas of the fly brain that have been shown to mediate olfactory memory formation.We tested the potential involvement of 134 miRNAs in intermediate-term memory (ITM) by silencing them individually through development and adulthood using specific complementary oligonucleotides called miRNA sponges (miR-SPs), (Ebert et al 2007;Loya et al 2009;Fulga et al 2015). Our study focused on ITM since changes in performance at this time point capture roles for miRNAs in both short-term memory and ITM as well as acute or developmental roles.…”

“…Crosses were kept at 25°with 70% relative humidity and with a 12 hr dark/light cycle. For the first screen, we crossed elav c155 -gal4 virgin females in a w CS10 genetic background with either uas-scramble-miR-SP or uas-miR-SP males in a w 1118 genetic background (Loya et al 2009;Fulga et al 2015). The sponge constructs and derivative fly lines are described in Fulga et al (2015).…”

“…We tested the potential involvement of 134 miRNAs in intermediate-term memory (ITM) by silencing them individually through development and adulthood using specific complementary oligonucleotides called miRNA sponges (miR-SPs), (Ebert et al 2007;Loya et al 2009;Fulga et al 2015). Our study focused on ITM since changes in performance at this time point capture roles for miRNAs in both short-term memory and ITM as well as acute or developmental roles.…”