A Y-shaped RNA structure in the 3′ untranslated region together with the trans-activator and core promoter of Red clover necrotic mosaic virus RNA2 is required for its negative-strand RNA synthesis

An, Mengnan; Iwakawa, Hiro-oki; Mine, Akira; Kaido, Masanori; Mise, Kazuyuki; Okuno, Tetsuro

doi:10.1016/j.virol.2010.05.022

Cited by 18 publications

(23 citation statements)

References 43 publications

(40 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Northern blot analysis confirmed the requirement of p27-YRE interaction for the negative-strand synthesis of RNA2 (Fig. 8A) (1,21,27). Western blot analysis in combination with BN-PAGE showed that the accumulation of the 480-kDa complex was increased by the addition of wild-type RNA2, whereas little increase in the accumulation of the 480-kDa complex was observed when RNA2 LM8 was added (Fig.…”

Section: Resultssupporting

confidence: 52%

“…Both p27 and p88 interact with RNA1 in a translation-coupled manner (27), and these interactions are important for the cis-preferential replication of RNA1 (66). p27 but not p88 binds specifically to the Y-shaped RNA element (YRE) of RNA2 in trans (27), and this interaction is essential for the recruitment of RNA2 into replication (1,21). In contrast, the functions of host proteins in RCNMV RNA replication are currently unknown.…”

mentioning

confidence: 99%

See 1 more Smart Citation

Differential Roles of Hsp70 and Hsp90 in the Assembly of the Replicase Complex of a Positive-Strand RNA Plant Virus

Mine

Hyodo

Tajima

et al. 2012

J Virol

Self Cite

View full text Add to dashboard Cite

Japan bAssembly of viral replicase complexes of eukaryotic positive-strand RNA viruses is a regulated process: multiple viral and host components must be assembled on intracellular membranes and ordered into quaternary complexes capable of synthesizing viral RNAs. However, the molecular mechanisms underlying this process are poorly understood. In this study, we used a model virus, Red clover necrotic mosaic virus (RCNMV), whose replicase complex can be detected readily as the 480-kDa functional protein complex. We found that host heat shock proteins Hsp70 and Hsp90 are required for RCNMV RNA replication and that they interact with p27, a virus-encoded component of the 480-kDa replicase complex, on the endoplasmic reticulum membrane. Using a cell-free viral translation/replication system in combination with specific inhibitors of Hsp70 and Hsp90, we found that inhibition of p27-Hsp70 interaction inhibits the formation of the 480-kDa complex but instead induces the accumulation of large complexes that are nonfunctional in viral RNA synthesis. In contrast, inhibition of p27-Hsp90 interaction did not induce such large complexes but rendered p27 incapable of binding to a specific viral RNA element, which is a critical step for the assembly of the 480-kDa replicase complex and viral RNA replication. Together, our results suggest that Hsp70 and Hsp90 regulate different steps in the assembly of the RCNMV replicase complex. Most plant and animal viruses are positive-strand RNA viruses, which have single-stranded messenger-sense genomic RNAs. These viruses often induce host membrane rearrangements to form organelle-like compartments in which viral genomic RNAs are replicated via negative-strand RNA intermediates by the viral replicase complexes (10). Viral replicase complexes comprise multiple proteins, including viral auxiliary proteins, viral RNAdependent RNA polymerase (RdRP), and host proteins (61). Viral replicase complexes have been studied extensively by characterizing their RdRP activities and the functions of the viral and host components of the complexes. These studies have provided important information about the mechanisms regulating genome replication (15, 19, 47, 89), viral pathogenicity (68, 69), and virushost interactions (24,25,32,33). However, an important question remains: how do multiple viral and host components assemble properly into the replicase complex?Molecular chaperones are essential for cell viability by ensuring folding of newly synthesized proteins, refolding of misfolded or aggregated proteins, protein complex assembly and disassembly, membrane translocation of organellar and secretory proteins, protein degradation, and activities of regulatory proteins in signal transduction pathways (12,18,51). In eukaryotic cells, the abundant and highly conserved molecular chaperones heat shock proteins Hsp70 and Hsp90 play central roles in the biological processes mentioned above, and the activities of Hsp70 and Hsp90 are modulated by a variety of cochaperones (37,80). Considering their pivotal roles i...

show abstract

Section: Resultssupporting

confidence: 52%

mentioning

confidence: 99%

Differential Roles of Hsp70 and Hsp90 in the Assembly of the Replicase Complex of a Positive-Strand RNA Plant Virus

Mine

Hyodo

Tajima

et al. 2012

J Virol

Self Cite

View full text Add to dashboard Cite

show abstract

“…pET-His-MBP-p33, expressing p33 with dual 6ϫHis and maltose-binding protein (MBP) tags, was also obtained earlier (32). pMAL-MS 2 33, containing TBSV p33 fused in-frame with bacteriophage MS2 coat protein (MS2-CP), was obtained by PCR amplification of the MS2-CP open reading frame (ORF) from pGBK-MS2-CFP (20) using primers 1576 (5=-GGAGTCTAGAGCTTCTAACTTTACT CAG) and 3269 (5=-CCGCCATGGGTAGATGCCGGAGTTTGC) containing XbaI and NcoI restriction sites. The TBSV p33 ORF was amplified from pMAL92 using primers 3313 (5=-CGGACCATGGGAGACCATCA AGAGAATG) and 2744 (5=-CGGCTGCAGCTATTTGACACCCAGG GAC) containing NcoI and PstI restriction sites, respectively.…”

Section: Methodsmentioning

confidence: 99%

“…pGBK-His33 and pGAD-His92, expressing only 6ϫHis-tagged p33 and p92, respectively, from the ADH1 promoter and pYC-DI72, were described previously (23). pGBK-Cup-(MS2) 2 -33 was obtained by fusing the CNV p33 ORF in frame with two copies of bacteriophage MS2-CP [(MS2) 2 , representing direct repeats of the MS2-CP ORF linked with a short linker (GAPGIHPGM) and also containing an internal poly-His tag]. The sequence of (MS2) 2 was amplified from p(MS2) 2 PCBP2 (39) using primers 4194 (5=-CGGACCATGGC GGATATCGAAGGTCCCACC) and 4196 (5= CCAGCCATGGGTCGTT TGGGTGATGGTGATGGTGGTGGCTGCCGCGTGG) containing an NcoI restriction site and cloned into NcoI-digested and dephosphorylated vector pGBK-His33/Cup1 (8).…”

Section: Methodsmentioning

confidence: 99%

“…The Brome mosaic virus (BMV) 1a protein participates in template selection and recruitment via interaction with the 1a-responsive element present in BMV RNAs (41,42). A Y-shaped RNA element in the 3= UTR in RNA2 of Red clover necrotic mosaic virus is specifically recognized by its cognate viral replication proteins, aiding recruitment of this viral RNA into replication (2,7). Dissection of the actual function(s) of cis-acting RNA elements such as those mentioned above can be hindered by the sequential and cycling nature of the plus-strand RNA replication, where a particular replication step depends on the previous step(s) and portions of the process are repeated in many cycles.…”

mentioning

confidence: 99%

See 1 more Smart Citation

Defining the Roles of cis -Acting RNA Elements in Tombusvirus Replicase Assembly In Vitro

Pathak

Pogany

et al. 2012

J Virol

View full text Add to dashboard Cite

In addition to its central role as a template for replication and translation, the viral plus-strand RNA genome also has nontemplate functions, such as recruitment to the site of replication and assembly of the viral replicase, activities that are mediated by cis-acting RNA elements within viral genomes. Two noncontiguous RNA elements, RII(؉)-SL (located internally in the tombusvirus genome) and RIV (located at the 3=-terminus), are involved in template recruitment into replication and replicase assembly; however, the importance of each of these RNA elements for these two distinct functions is not fully elucidated. We used an in vitro replicase assembly assay based on yeast cell extract and purified recombinant tombusvirus replication proteins to show that RII(؉)-SL, in addition to its known requirement for recruitment of the plus-strand RNA into replication, is also necessary for assembly of an active viral replicase complex. Additional studies using a novel two-component RNA system revealed that the recruitment function of RII(؉)-SL can be provided in trans by a separate RNA and that the replication silencer element, located within RIV, defines the template that is used for initiation of minus-strand synthesis. Collectively, this work has revealed new functions for tombusvirus cis-acting RNA elements and provided insights into the pioneering round of minus-strand synthesis. P lus-strand RNA viruses exhibit many similarities during genome replication, including the formation of membranebound viral replicase complexes, the production of minus-strand and abundant plus-strand RNAs, and the use of co-opted host factors (1,15,16,18). One of the best-studied plus-strand RNA viruses is Tomato bushy stunt virus (TBSV), which has a single 4,800-nucleotide (nt) RNA genome (43). The virus-encoded replication proteins p33 RNA chaperone and p92 pol RNA-dependent RNA polymerase (RdRp) participate in the formation of the membrane-bound viral replicase complex, which also contains several host proteins (3,12,16,38,40).Replication of TBSV and other plus-strand RNA viruses involve several sequential steps, including selection of the viral plusstrand RNA template for replication, recruitment of the viral plusstrand RNA and the viral replication proteins from the cytosol to the subcellular membrane surfaces where replication takes place, assembly and activation of the viral replicase, minus-strand and then plus-strand RNA synthesis, and the release of progeny plusstrand RNAs from the replicase complex (5,15,17). This complex process helps to ensure that authentic viral templates are replicated and that the replication process is rapid and efficient.The TBSV plus-strand RNA plays multiple roles during viral replication. In addition to its main function as a store of genetic information, the viral plus-strand RNA also regulates its own intracellular localization and recruitment to the site of RNA replication (20,26,32,33,44). Moreover, the TBSV plus-strand RNA serves as an assembly platform for the viral replicase, consisting of vir...

show abstract

Replication of Plant Viruses

Hull

2014

Plant Virology

View full text Add to dashboard Cite

A Y-shaped RNA structure in the 3′ untranslated region together with the trans-activator and core promoter of Red clover necrotic mosaic virus RNA2 is required for its negative-strand RNA synthesis

Cited by 18 publications

References 43 publications

Differential Roles of Hsp70 and Hsp90 in the Assembly of the Replicase Complex of a Positive-Strand RNA Plant Virus

Differential Roles of Hsp70 and Hsp90 in the Assembly of the Replicase Complex of a Positive-Strand RNA Plant Virus

Defining the Roles of cis -Acting RNA Elements in Tombusvirus Replicase Assembly In Vitro

Replication of Plant Viruses

Contact Info

Product

Resources

About