Aberrant expression of the gastric mucin MUC6 in human pulmonary adenocarcinoma xenografts

Hamamoto, Atsushi; Abe, Yoshiyuki; Nishi, Masatake; Fujimori, Sakashi; Ohnishi, Yasuyuki; Yamazaki, Hitoshi; Oida, Yasuhisa; Miyazaki, Noriyuki; Inada, Ken Ichi; Ueyama, Yoshito; Iwasaki, Masayuki; Inoué, Hiroshi; Nakamura, Masato

doi:10.3892/ijo.26.4.891

Cited by 13 publications

(14 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A large body of evidences indicates that 11p deletion is closely associated with gastric carcinogenesis (Reis et al 2000;Ranzani et al 1993) and therefore we speculate that reduced expression might be attributable to such chromosome loss. The role of altered MUC6 expression in the progression of malignancies remains elusive although several groups have focused on this point (Pinto-de-Sousa et al 2004;Cozzi et al 2005;Hamamoto et al 2005;Ho et al 1995;Reis et al 2000). In this study, the results demonstrated gastric carcinomas with no MUC6 expression to display large tumor size, deep invasion, frequent lymphatic or venous invasion, and high lymph node metastasis, suggesting that down-regulation of MUC6 expression is closely linked to progression and might be considered as a good indicator of pathobiological behaviors.…”

Section: Discussionmentioning

confidence: 74%

“…The N-terminal domain shows 36.2% amino acid identity with the Nterminal domain of MUC2 and a conserved C-terminal proteolytic cleavage site despite the lack of D4, B and C domains (Cozzi et al 2005;Rousseau et al 2004). It has been demonstrated that MUC6 plays an essential role in epithelial cytoprotection against a wide range of substances (Durai et al 2006), generally being expressed in the duodenum, gallbladder, bronchi, endocervix and pancreas (Byrd and Bresalier 2004;Pinto-de-Sousa et al 2004;Cozzi et al 2005;Rousseau et al 2004;Hamamoto et al 2005). MUC6 is also reported to be expressed in mucopeptic cells of the neck zone and in pyloric glands of the antrum (Ho et al 2004), but links between changes in expression during the genesis and progression of gastric carcinomas have hitherto not attracted attention.…”

Section: Introductionmentioning

confidence: 96%

See 1 more Smart Citation

MUC6 down-regulation correlates with gastric carcinoma progression and a poor prognosis: an immunohistochemical study with tissue microarrays

Zheng

Takahashi

Nakajima

et al. 2006

J Cancer Res Clin Oncol

View full text Add to dashboard Cite

show abstract

Section: Discussionmentioning

confidence: 74%

Section: Introductionmentioning

confidence: 96%

MUC6 down-regulation correlates with gastric carcinoma progression and a poor prognosis: an immunohistochemical study with tissue microarrays

Zheng

Takahashi

Nakajima

et al. 2006

J Cancer Res Clin Oncol

View full text Add to dashboard Cite

show abstract

“…Since the characteristic mucin expression pattern for each organ may be maintained during neoplastic transformation, 15, 16 or altered during carcinogenesis 13, examination of mucin expression could be informative for the pathogenesis of lung adenocarcinoma. Indeed Hamamoto et al reported that aberrant expression of MUC6 was related to carcinogenesis in pulmonary adenocarcinoma using a xenograft model 17. It has been reported that carcinoma cells located in the protruding portions of m‐BAC differentiate into gastric‐type surface mucus cells 18, 19.…”

Section: Discussionmentioning

confidence: 99%

Comparison of the immunophenotypes of signet-ring cell carcinoma, solid adenocarcinoma with mucin production, and mucinous bronchioloalveolar carcinoma of the lung characterized by the presence of cytoplasmic mucin

et al. 2006

View full text Add to dashboard Cite

The latest World Health Organization (WHO) classification divides adenocarcinoma mainly into adenocarcinoma mixed subtypes, acinar adenocarcinoma, papillary adenocarcinoma, bronchioloalveolar carcinoma, and solid adenocarcinoma with mucin production, and it mentions several variants, including fetal adenocarcinoma, mucinous ("colloid") adenocarcinoma, mucinous cystadenocarcinoma, signet-ring adenocarcinoma, and clear cell adenocarcinoma. In general, the mucin-producing adenocarcinoma of the lung comprises signet-ring cell carcinoma (SRCC), solid adenocarcinoma with mucin production (SA), and mucinous bronchioloalveolar carcinoma (m-BAC), mucinous ("colloid") adenocarcinomas and/or mucinous cystadenocarcinoma, and mucoepidermoid carcinoma. As SRCC, SA, and m-BAC exhibit distinct clinical features, it is important to identify differences in their immunohistochemical characteristics to better understand their histogenesis. In this study we analysed SRCC, SA, m-BAC, normal lung, and foregut-related secretory tissue for immunohistochemical differences using tissue microarrays. SRCC and SA showed high expression of MUC1 (97.4% and 100%, respectively), cytokeratin (CK) 7 (both 100%), and thyroid transcription factor-1 (TTF-1) (81.1% and 100%, respectively). They also showed low expression of MUC5AC (25.5% and 21.1%, respectively) and MUC6 (18.3% and 10.5%, respectively), whereas m-BAC showed high expression of MUC5AC (97.5%), MUC6 (75.0%), and CK7 (94.7%), but low expression of MUC1 (57.5%), and TTF-1 (27.5%). Hierarchical clustering showed that the immunophenotypes of SRCC and SA belong to the same category as alveolar lining cells, whereas m-BAC clustered onto another branch with gastric foveolar cells and bronchial goblet cells. These immunohistochemical findings support the results of our previous clinicopathological analysis of SRCC of the lung showing that SRCC occurs anatomically in the peripheral portion of the lung rather than in the bronchial gland-bearing portion.

show abstract

“…Complementary DNA (cDNA) was synthesized from 1 μg of total RNA. Real-time quantitative PCR for NRP1, NRP2, VEGF-A and ß-actin mRNA was performed according to the manufacturer's recommendations and our previous reports (17)(18)(19). The primers used were as follows: NRP-1 forward AAATGC GAATGGCTGATTCAG, reverse CTCCATCGAAGACTT CCACGTAGT, and probe TCAACCCTCACTTCGATTTG GAGGACA; NRP-2 forward CACCCTCTGAACTTCGTT CATCGACGG, reverse GGATGGCATTCCACATGTTG, and probe TGTGAAAGGTCAGGGAGAGGAT.…”

Section: Methodsmentioning

confidence: 99%

The preserved expression of neuropilin (NRP) 1 contributes to a better prognosis in colon cancer

Kamiya

Kawakami²,

Abe³

et al. 2006

Oncol Rep

Self Cite

View full text Add to dashboard Cite

Abstract. Vascular endothelial growth factor A (VEGF-A)plays an essential role in tumor progression through stromal neovascularization in malignant solid tumors. Neuropilin (NRP) is considered to be the specific receptor for limited types of VEGF-A isoform, VEGF165. The clinicopathological implications of NRP are not well understood in colon cancer, while almost all colon cancers overexpressed VEGF-A. We examined the expression levels of NRP1 and NRP2 genes in 54 colon cancer cases and paired extraneoplastic tissue with quantitative real-time polymerase chain reaction. The gene expression levels of NRP1 in the tumor (0.431±0.583) were significantly decreased compared to those in the extraneoplastic tissue (0.754±0.799) (paired t-test, p=0.0208). On the other hand, the gene expression levels of NRP2 in the tumor (0.763±0.791) were not decreased compared to those in the extraneoplastic tissue (0.508±0.386) (paired t-test, p=0.0511). Twenty cases, with preserved expression of the NRP1 gene in the tumor, showed a better prognosis as compared to the 34 cases with decreased NRP1 expression (p=0.0258, log-rank test). No significant relationship was noted between NRP2 gene expression and prognosis. The results suggested that preserved NRP1 expression provides colon cancer patients with a better prognosis.

show abstract

Aberrant expression of the gastric mucin MUC6 in human pulmonary adenocarcinoma xenografts

Cited by 13 publications

References 0 publications

MUC6 down-regulation correlates with gastric carcinoma progression and a poor prognosis: an immunohistochemical study with tissue microarrays

MUC6 down-regulation correlates with gastric carcinoma progression and a poor prognosis: an immunohistochemical study with tissue microarrays

Comparison of the immunophenotypes of signet-ring cell carcinoma, solid adenocarcinoma with mucin production, and mucinous bronchioloalveolar carcinoma of the lung characterized by the presence of cytoplasmic mucin

The preserved expression of neuropilin (NRP) 1 contributes to a better prognosis in colon cancer

Contact Info

Product

Resources

About