Absolute Quantification of RNA or DNA Using Acid Hydrolysis and Mass Spectrometry

Abstract

Accurate, traceable quantification of ribonucleotide or deoxyribonucleotide oligomers is achievable using acid hydrolysis and isotope dilution mass spectrometry (ID-MS). In this work, formic acid hydrolysis is demonstrated to generate stoichiometric release of nucleobases from intact oligonucleotides, which then can be measured by ID-MS, facilitating true and precise absolute quantification of RNA, short linearized DNA, or genomic DNA. Surrogate nucleobases are quantified with a liquid chromatography-tandem mass spectrometry (LC-MS/MS) workflow, using multiple reaction monitoring (MRM). Nucleobases were chromatographically resolved using a novel cation-exchange separation, incorporating a pH gradient. Trueness of this quantitative assay is estimated from agreement among the surrogate nucleobases and by comparison to concentrations provided for commercial materials or Standard Reference Materials (SRMs) from the National Institute of Standards and Technology (NIST). Comparable concentration estimates using NanoDrop spectrophotometry or established from droplet-digital polymerase chain reaction (ddPCR) techniques agree well with the results. Acid hydrolysis-ID-LC-MS/MS provides excellent quantitative selectivity and accuracy while enabling traceability to mass unit. Additionally, this approach can be uniquely useful for quantifying modified nucleobases or mixtures.

Foodborne Transmission and Clinical Symptoms of Honey Bee Viruses in Ants Lasius spp.

“…To monitor the efficiency of the RNA purification and cDNA synthesis, we tested for β-actin in the samples from the feeding experiment [53]. The same was achieved for the samples of the behavioural experiment by adding 0.3 ng Ambion™ RNA Control 250 to each sample at the first extraction step [54].…”

Varying impact of neonicotinoid insecticide and acute bee paralysis virus across castes and colonies of black garden ants, Lasius niger (Hymenoptera: Formicidae)

“…Fifty microlitres of the homogenate were then used for the RNA extraction with a NucleoSpin RNA II kit (MACHEREY–NAGEL, Oensingen, Switzerland). 0.3 ng Ambion RNA Control 250 was added to each sample at the first extraction step to monitor the efficiency of the RNA purification and cDNA synthesis 93 . After elution in 30 µL of elution buffer, RNA was stored at − 80 °C.…”

“…The obtained cDNA was diluted 1/5 and used for RT-qPCR to estimate ABPV titres using a KAPA SYBR FAST Universal qPCR kit (Kapa Biosystems, Wilmington, North Carolina, United States). A duplicate of each sample was run for both the targeted virus and the exogenous internal reference in a 12 μL reaction mix containing SYBR green reaction mix (6 μL), Milli-Q water (2.52 μL), diluted cDNA (3 μL) and each 0.24 μL of the forward and reverse primers (ABPV F6548—TCATACCTGCCGATCAAG, ABPV B6707—CTGAATAATACTGTGCGTATC, 197 bp 94 ; RNA 250-F—TGGTGCCTGGGCGGTAAAG, RNA 250-B—TGCGGGGACTCACTGGCTG, 227 bp 93 ). In addition, four ten-folds serial dilutions (10 −2 to 10 −5 ng) of purified PCR products used as standard curves and two no-template negatives were included on each plate.…”

Recent developments in the characterization of nucleic acids by liquid chromatography, capillary electrophoresis, ion mobility, and mass spectrometry (2010–2020)

“…The relative quantitation of tRNAs has been previously performed by enzyme‐mediated isotope labelling of the RNA in 16 O or 18 O water followed by analysis with LC–MS [77]. Recently, acid hydrolysis and isotope dilution MS (ID‐MS) were explored for the quantification of ribonucleotide or deoxyribonucleotide oligomers [78]. Acid hydrolysis with formic acid provided stoichiometric release of the bases that were separated with LC and quantified using MRM.…”