Abundance and Localization of Symbiotic Bacterial Communities in the Fly Parasitoid Spalangia cameroni

Shalom, Sarit Rohkin; Weiß, Benjamin; Lalzar, Maya; Kaltenpoth, Martin; Chiel, Elad

doi:10.1128/aem.02549-21

Cited by 3 publications

(2 citation statements)

References 63 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…If both Buchnera and Arsenophonus were detected in bacteriocytes, it indicated that these two endosymbionts coexist in the same bacteriocytes. Buchnera and Arsenophonus were visualized in CA2, CA3, and CA4 aphids using FISH as described previously ( 64 ). The fluorochrome-labeled oligonucleotide probes for Buchnera and Arsenophonus were 5′-Cy3- CCTCTTTTGGGTAGATCC -3′ and 5′-Cy5- CCTTAACACCTTCCTCACGAC -3′, respectively ( 21 , 65 , 66 ).…”

Section: Methodsmentioning

confidence: 99%

Arsenophonus Interacts with Buchnera to Improve Growth Performance of Aphids under Amino Acid Stress

et al. 2023

View full text Add to dashboard Cite

The obligate symbiont Buchnera can synthesize amino acids for aphids. In this study, we found that a facultative symbiont, Arsenophonus , can help improve aphids’ growth performance under amino acid deficiency stress by changing the relative abundance of Buchnera and the expression levels of amino acid synthase genes. This study highlights the interaction between Arsenophonus and Buchnera to ameliorate aphid growth under amino acid stress.

show abstract

Section: Methodsmentioning

confidence: 99%

Arsenophonus Interacts with Buchnera to Improve Growth Performance of Aphids under Amino Acid Stress

et al. 2023

View full text Add to dashboard Cite

show abstract

“…In invertebrates and terrestrial plants, the importance of a host‐associated microbiome for host nutrition, immune response and biocontrol are now well recognized (Lyu et al, 2021; Pang et al, 2021; Salem & Kaltenpoth, 2022). Marine invertebrates such as sponges and corals have been a particular focus of holobiont research, with contemporary technologies such as metatranscriptomics and metabolomics, as well as approaches such as fluorescence in situ hybridization–nanoscale secondary ion mass spectrometry (FISH‐NanoSIMS) contributing to our understanding of holobiont functioning (Engelberts et al, 2021; Pita et al, 2018; Rohkin Shalom et al, 2022; Taylor et al, 2022). Such approaches can be particularly fruitful when integrated with experimental and field studies (Wegley Kelly et al, 2021).…”

Section: The Holobiont Conceptmentioning

confidence: 99%

Beyond the theory: From holobiont concept to microbiome engineering

Biggs

Taylor

Middleton

2023

Environmental Microbiology

View full text Add to dashboard Cite

Holobiont research has increasingly moved from descriptive studies to sophisticated field-and laboratory-based manipulations; however, the extent to which changes in the holobiont persist remains largely unknown. In this Burning Question, we ask whether the underlying principles of the holobiont concept, whereby an externally applied evolutionary pressure can lead to a beneficial change in host-associated microbial community composition, could be used to facilitate microbiome engineering and thereby addition of a new ecosystem service that persists across generations. The answer to this question has potential implications for diverse fields including symbiosis, conservation and biotechnology.

show abstract

Sodalis praecaptivus subsp. spalangiae subsp. nov., a nascent bacterial endosymbiont isolated from the parasitoid wasp, Spalangia cameroni

Teh,

Shalom,

James

et al. 2024

International Journal of Systematic and Evolutionary Microbiology

View full text Add to dashboard Cite

An endosymbiotic bacterium of the genus Sodalis, designated as strain HZT, was cultured from the parasitoid wasp Spalangia cameroni, which develops on the pupae of various host flies. The bacterium was detected in S. cameroni developed on houseflies, Musca domestica, in a poultry facility in Hazon, northern Israel. After culturing, this bacterium displayed no surface motility on Luria–Bertani agar and was rod-shaped and irregular in size, ~10–30 nm in diameter and 5–20 µm in length. Phylogenetic analyses revealed that strain HZT is closely related to Sodalis praecaptivus strain HST, a free-living species of the genus Sodalis that includes many insect endosymbionts. Although these bacteria maintain >98% sequence identity in shared genes, genomic characterization revealed that strain HZT has undergone substantial reductive evolution, such that it lacks many gene functions that are maintained in S. praecaptivus strain HST. Based on the results of phylogenetic, genomic and chemotaxonomic analyses, we propose that this endosymbiont should be classified in a new subspecies as S. praecaptivus subsp. spalangiae subsp. nov. The type strain for this new subspecies is HZT (=ATCC TSD-398T=NCIMB 15482T). The subspecies Sodalis praecaptivus subsp. praecaptivus strain HST is created automatically with the type strain ATCC BAA-2554T (=DSMZ 27494T).

show abstract

Abundance and Localization of Symbiotic Bacterial Communities in the Fly Parasitoid Spalangia cameroni

Cited by 3 publications

References 63 publications

Arsenophonus Interacts with Buchnera to Improve Growth Performance of Aphids under Amino Acid Stress

Arsenophonus Interacts with Buchnera to Improve Growth Performance of Aphids under Amino Acid Stress

Beyond the theory: From holobiont concept to microbiome engineering

Sodalis praecaptivus subsp. spalangiae subsp. nov., a nascent bacterial endosymbiont isolated from the parasitoid wasp, Spalangia cameroni

Contact Info

Product

Resources

About