Accurate, simple, and inexpensive assays to diagnose F8 gene inversion mutations in hemophilia A patients and carriers

Abstract

Key Points• Improved assays to detect intron 22 and intron 1 inversions in the F8 gene have been developed.• These assays can efficiently detect or rule out the most common genetic mutations resulting in hemophilia A.The most frequent mutations resulting in hemophilia A are an intron 22 or intron 1 gene inversion, which together cause ;50% of severe hemophilia A cases. We report a simple and accurate RNA-based assay to detect these mutations in patients and heterozygous carriers.The assays do not require specialized equipment or expensive reagents; therefore, they may provide useful and economic protocols that could be standardized for central laboratory testing. RNA is purified from a blood sample, and reverse transcription nested polymerase chain reaction (RT-NPCR) reactions amplify DNA fragments with the F8 sequence spanning the exon 22 to 23 splice site (intron 22 inversion test) or the exon 1 to 2 splice site (intron 1 inversion test). These sequences will be amplified only from F8 RNA without an intron 22 or intron 1 inversion mutation, respectively. Additional RT-NPCR reactions are then carried out to amplify the inverted sequences extending from F8 exon 19 to the first in-frame stop codon within intron 22 or a chimeric transcript containing F8 exon 1 and the VBP1 gene. These latter 2 products are produced only by individuals with an intron 22 or intron 1 inversion mutation, respectively. The intron 22 inversion mutations may be further classified (eg, as type 1 or type 2, reflecting the specific homologous recombination sites) by the standard DNA-based "inverse-shifting" PCR assay if desired. Efficient Bcl I and T4 DNA ligase enzymes that cleave and ligate DNA in minutes were used, which is a substantial improvement over previous protocols that required overnight incubations. These protocols can accurately detect F8 inversion mutations via same-day testing of patient samples.

The humanized DRAGA mouse (HLA-A2. HLA-DR4. RAG1 KO. IL-2R g c KO. NOD) establishes inducible and transmissible models for influenza type A infections

“…FVIII protein, which is secreted by the vascular ECs, 61,62 is an essential coagulation cofactor that amplifies thrombin generation, and hence blood clotting by accelerating the enzymatic activity of the serine protease factor IXa. 29,63 We found that DRAGA lung epithelium was reconstituted with 10-12% of human CD36 + ECs. Furthermore, severe H1N1/PR8 infection of DRAGA mice resulted in undetectable human and murine F8 mRNA expression in the damaged lung areas.…”

“…The so-called "cytokine storm" referring to the release of inflammatory cytokines by infiltrating lymphocytes in infected lungs can be a significant damaging event. 29 Severely infected F1, M4, and M5 mice showed slightly, but not significantly higher IFNγ RNA expression in affected areas of the lungs than non-infected mice (*p = .03), whereas the TNFα RNA expression was significantly higher in the infected mice (*p = .004) ( Figure 2). No differences in human IFNγ and TNFα RNA expression were detected by RT-qPCR between the non-affected lung area from infected and non-infected mice (data not shown), and no human IFNγ and TNFα RNA was present in non-HIS humanized DRAGA mice ( Figure 2).…”

“…Briefly, a 50 μl reaction mix for each sample was prepared in 10 μl of 5x RT-PCR buffer, 2μl of dNTP mix, 2μl of Enzyme mix, 1uM of human or murine F8-specific primers, 1μM of RNA template, and RNAse-free water. Nested PCR primers to amplify the human F8 exon 22-23 junction region were as described, 29 and similar primers to amplify this same region in mice were designed in-house. The murine F8 primers were: exon 22 FWD1: GTAGATCTGTTGGCAC CAATG; exon 24 REV: CTTCCCTGGAGGTG AAGTCG; exon 22: FWD2: ACCAATGATTGTTCATGGCATCAAGA; exon 23 REV: TGCAAACGGATATATCGAGCAATAA.…”

The severe spontaneous bleeding phenotype in a novel hemophilia A rat model is rescued by platelet FVIII expression

“…Inversion disruption of the F8 gene is not only the most common variant found in patients with severe HA, [30][31][32][33][34][35][36] but it is also the most common found in canine HA models. 37 Approximately one-half of cases of severe HA are caused by an inversion variant of the F8 gene, with a frequency of 40% to 50% in intron 22 and 1% to 5% in intron 1.…”

Droplet digital PCR and mile‐post analysis for the detection of F8 int1h inversions

“…Inv1 inversions are present in 1%–2% of HA patients 1 . Inv1 genotyping has been performed using long‐range polymerase chain reaction (PCR), 2 inverse‐shifting PCR, 3 and an RNA‐based method 4 …”