Acinetobacter cyclohexanone monooxygenase: gene cloning and sequence determination

Abstract

The gene coding for cyclohexanone monooxygenase from Acinetobacter sp. strain NCIB 9871 was isolated by immunological screening methods. We located and determined the nucleotide sequence of the gene. The structural gene is 1,626 nucleotides long and codes for a polypeptide of 542 amino acids; 389 nucleotides 5' and 108 nucleotides 3' of the-coding region are also reported. The complete amino acid sequence of the enzyme was derived by translation of the nucleotide sequence. From a comparison of the amino acid sequence with consensus sequences of nucleotide-binding folds, we identified a potential flavin-binding site at the NH2 terminus of the enzyme (residues 6 to 18) and a potential nicotinamide-binding site extending from residue 176 to residue 208 of the protein. An overproduction system for the gene to facilitate genetic manipulations was also constructed by using the tac promoter vector pKK223-3 in Escherichia coli. Bacteria can degrade a large variety of organic compounds by oxygenating metabolic routes. The degradation of monocyclic aromatic, polycyclic aromatic, and complex heteroaromatic structures such as lignin by both monooxygenases and dioxygenases has been intensively studied. Microbes can also decompose alicyclic compounds by oxygenating routes, with the breakdown of the bicyclic ketone camphor and the monocyclic ketone cyclohexanone by soil bacteria being prototypic cases. In these instances, a difficult step for dissimilatory metabolism is the ring fragmentation to yield readily metabolizable acyclic fragments. In both camphor and cyclohexanone degradation as well as in steroidal ketone utilization, the fragmentation strategy is executed in two steps: (i) oxygenating ring expansion of cyclic ketone to lactone followed by (ii) hydrolytic decomposition of lactone to acyclic hydroxy acid. The ketone-to-lactone conversion is the biological equivalent of Baeyer-Villiger oxidation. All monooxygenases known to date that effect Baeyer-Villigertype conversions are flavoproteins, and of these, the best characterized is the cyclohexanone monooxygenase from acinetobacteria (4, 6, 16, 19; J. A. Latham, Jr., Ph.D. thesis, Massachusetts Institute of Technology, Cambridge, 1985).We have previously shown that the purified cyclohexanone monooxygenase (Mr, 59,000) is in fact a remarkably versatile oxygenation catalyst that uses the bound flavin adenine dinucleotide (FAD)-4a-OOH oxygenating intermediate to initiate oxygen transfer to both electrophilic substrate sites, such as the carbonyl of ketones and aldehydes, and nucleophilic substrate sites, such as sulfides and selenides, to yield the corresponding sulfoxide and selenoxide products. Further, this oxygenase oxygenates at nitrogen, trivalent phosphorus, and boron sites in boronic acids, making it the most broad-based flavoprotein oxygenase known. To date, none of the Baeyer-Villiger-type flavoprotein monooxygenases have been the subject of significant structural analysis. To that end, we report the cloning of the gene for the Acinetobacter sp. strain NCIB 987...

Simultaneous Identification of Two Cyclohexanone Oxidation Genes from an Environmental Brevibacterium Isolate Using mRNA Differential Display

“…These were found in the gamma proteobacterium Acinetobacter sp. strain NCIB 9871 (3,16). They include the gene of the cyclohexanone monooxygenase (chnB) (3).…”

Genetic Analysis of a Gene Cluster for Cyclohexanol Oxidation in Acinetobacter sp. Strain SE19 by In Vitro Transposition

“…ChnB has high homology to a known cyclohexanone monooxygenase from Acinetobacter sp. strain NCIB 9871 (7,30). Accumulation of cyclohexanone as the major intermediate in the ChnB insertion mutant also confirmed that the enzymatic reaction catalyzed by the cyclohexanone monooxygenase was blocked in the ChnB mutant.…”

“…Two primers, monoL (GAGTCTGAGCATATGTCACAAAAAATGGATTTTG) and monoR (GAG TCTGAGGGATCCTTAGGCATTGGCAGGTTGCTTGAT), were designed based on the published sequence of the cyclohexanone monooxygenase gene of Acinetobacter sp. strain NCIB 9871 (7). PCR was performed in a Perkin-Elmer (Foster City, Calif.) GeneAmp9600.…”

“…The bacterial strain that grows on cyclohexanol used in this study was isolated from an enrichment of activated sludge obtained from an industrial wastewater bioreactor. The enrichment culture was established by inoculating 1 ml of activated sludge into 20 ml of S12 medium (50 mM potassium phosphate buffer [pH 7.0], 10 mM ammonium sulfate, 2 mM MgCl 2 , 0.7 mM CaCl 2 , 50 M MnCl 2 , 1 M FeCl 3 , 1 M ZnCl 3 , 1.72 M CuSO 4 , 2.53 M CoCl 2 , 2.42 M Na 2 MoO 2 , 0.0001% FeSO 4 ) in a 125-ml screw-cap Erlenmeyer flask. It was supplemented with 100-ppm cyclopentanol added directly to the culture medium and was incubated at 35°C with reciprocal shaking.…”

“…The broad spectrum of activity of cyclohexanone monooxygenase has been extensively studied (4) and its gene sequence from Acinetobacter sp. strain NCIB 9871 has been reported (7). However, very little is known about other genes and the genetic organization of the cyclohexanol oxidative pathway.…”